ID: 1131283238

View in Genome Browser
Species Human (GRCh38)
Location 15:91037967-91037989
Sequence GTGAAGTTTGGAGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131283238_1131283254 30 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283254 15:91038020-91038042 GGAGGGAGGGAGGAGATGGTGGG No data
1131283238_1131283247 12 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283247 15:91038002-91038024 GCAAGTAGTAGAGGGGAAGGAGG No data
1131283238_1131283253 29 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283253 15:91038019-91038041 AGGAGGGAGGGAGGAGATGGTGG No data
1131283238_1131283252 26 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283252 15:91038016-91038038 GGAAGGAGGGAGGGAGGAGATGG 0: 6
1: 43
2: 493
3: 2454
4: 10992
1131283238_1131283243 3 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283243 15:91037993-91038015 TGCTGGGGAGCAAGTAGTAGAGG No data
1131283238_1131283250 17 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283250 15:91038007-91038029 TAGTAGAGGGGAAGGAGGGAGGG No data
1131283238_1131283245 5 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283245 15:91037995-91038017 CTGGGGAGCAAGTAGTAGAGGGG No data
1131283238_1131283246 9 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283246 15:91037999-91038021 GGAGCAAGTAGTAGAGGGGAAGG No data
1131283238_1131283244 4 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283244 15:91037994-91038016 GCTGGGGAGCAAGTAGTAGAGGG No data
1131283238_1131283251 20 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG No data
1131283238_1131283248 13 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283248 15:91038003-91038025 CAAGTAGTAGAGGGGAAGGAGGG No data
1131283238_1131283249 16 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283249 15:91038006-91038028 GTAGTAGAGGGGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131283238 Original CRISPR GTGAAGTTTGGAGCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr