ID: 1131283251

View in Genome Browser
Species Human (GRCh38)
Location 15:91038010-91038032
Sequence TAGAGGGGAAGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131283242_1131283251 8 Left 1131283242 15:91037979-91038001 CCAAACTTCACTGCTGCTGGGGA No data
Right 1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG No data
1131283238_1131283251 20 Left 1131283238 15:91037967-91037989 CCAGCAGCAGCTCCAAACTTCAC No data
Right 1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131283251 Original CRISPR TAGAGGGGAAGGAGGGAGGG AGG Intergenic
No off target data available for this crispr