ID: 1131284086

View in Genome Browser
Species Human (GRCh38)
Location 15:91043288-91043310
Sequence GGTTAAACATAGTCCCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131284082_1131284086 3 Left 1131284082 15:91043262-91043284 CCTCAGCTCTCAAGGTTTAACCA No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284078_1131284086 12 Left 1131284078 15:91043253-91043275 CCTCCTCCTCCTCAGCTCTCAAG No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284077_1131284086 15 Left 1131284077 15:91043250-91043272 CCTCCTCCTCCTCCTCAGCTCTC No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284080_1131284086 9 Left 1131284080 15:91043256-91043278 CCTCCTCCTCAGCTCTCAAGGTT No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284081_1131284086 6 Left 1131284081 15:91043259-91043281 CCTCCTCAGCTCTCAAGGTTTAA No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284076_1131284086 21 Left 1131284076 15:91043244-91043266 CCTCTTCCTCCTCCTCCTCCTCA 0: 20
1: 494
2: 4158
3: 9956
4: 19564
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284074_1131284086 30 Left 1131284074 15:91043235-91043257 CCTCCTGTTCCTCTTCCTCCTCC No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data
1131284075_1131284086 27 Left 1131284075 15:91043238-91043260 CCTGTTCCTCTTCCTCCTCCTCC No data
Right 1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131284086 Original CRISPR GGTTAAACATAGTCCCCACA GGG Intergenic
No off target data available for this crispr