ID: 1131287326

View in Genome Browser
Species Human (GRCh38)
Location 15:91071471-91071493
Sequence AGCACTTACCTCTCCACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131287325_1131287326 -5 Left 1131287325 15:91071453-91071475 CCACATTTGTGTTGAGCAAGCAC No data
Right 1131287326 15:91071471-91071493 AGCACTTACCTCTCCACCCATGG No data
1131287324_1131287326 3 Left 1131287324 15:91071445-91071467 CCAGCAGACCACATTTGTGTTGA No data
Right 1131287326 15:91071471-91071493 AGCACTTACCTCTCCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131287326 Original CRISPR AGCACTTACCTCTCCACCCA TGG Intergenic
No off target data available for this crispr