ID: 1131300597

View in Genome Browser
Species Human (GRCh38)
Location 15:91196479-91196501
Sequence TGCAGGGCCCAGCACTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131300597 Original CRISPR TGCAGGGCCCAGCACTATGA AGG Intronic
900610799 1:3543828-3543850 TGCAGAGCCCAGCATGGTGACGG - Intronic
901556223 1:10033154-10033176 GGCAGAGCCCAGCACTGTAAGGG - Intronic
901930379 1:12593234-12593256 TGCAGGGCCGAGACCTAGGAGGG - Intronic
903753714 1:25646339-25646361 TGGAAGGCCCAGGACGATGAGGG - Intronic
905334035 1:37231946-37231968 TGCAGGGCCCAGCAGGGTGCTGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
907389832 1:54151045-54151067 TGCTGGGGCCAGCAGTATCAAGG + Intronic
907412182 1:54290566-54290588 GGCAGGGCCCGGCAGTATGGTGG - Intronic
907458123 1:54588784-54588806 TGCAGGGCTCAGCAGAGTGAAGG + Intronic
909686014 1:78349612-78349634 TGCAAGGCCCACCAATATCAGGG - Intronic
910130682 1:83901949-83901971 TGGAGTGGCCAGCACCATGAAGG - Intronic
912593516 1:110851239-110851261 TGCAGGGCAGAGCCCCATGATGG - Intergenic
913340465 1:117753154-117753176 ACCAGGGCCCAGCAGGATGAGGG + Intergenic
915583593 1:156831038-156831060 TTCAGGGCCCAGCAGCATGCAGG - Intronic
915679390 1:157565596-157565618 CACAGGGCCCAGCACTCAGAAGG + Intergenic
916051670 1:161040813-161040835 CGCAGGGCTCAGCATAATGAAGG - Exonic
917063742 1:171069012-171069034 TGCAGAGGCCAGTACTATGACGG + Intergenic
918275282 1:182948165-182948187 TGCAGGGCCCTGCACTGTTCAGG + Intronic
919814273 1:201427972-201427994 TGCAGGTCCCAGCACTGGGCAGG + Intronic
919887050 1:201942211-201942233 TGCAGGGCCCAGCACACAGCAGG - Intronic
923246262 1:232135767-232135789 AACAGGGCCCAGCACTCAGAAGG - Intergenic
923259116 1:232249944-232249966 TGCTTGGCGCAGCTCTATGAGGG - Intergenic
923763447 1:236869830-236869852 GGCAGAGACCAGCACTATGAGGG - Intronic
1067843561 10:49700813-49700835 CCCAGAGCCCAGAACTATGAGGG + Intronic
1068833077 10:61520360-61520382 TGCTGGCCACAACACTATGATGG + Intergenic
1072500099 10:96006799-96006821 AGCAGGGCCAGGCACTCTGATGG - Intronic
1073475008 10:103747040-103747062 CTCAGGGCCCAGCACAAGGACGG + Intronic
1074535872 10:114328402-114328424 TGCAGGGCCCAGCCCTCAGGTGG + Intronic
1074814148 10:117132195-117132217 CGCAGGGCCCCGCACTATAGGGG + Intronic
1075687724 10:124375930-124375952 CGCTGGGCCTAGCACTTTGAGGG - Intergenic
1075701153 10:124470154-124470176 GGCAGGGCCCAGCACAGCGAGGG + Intronic
1077351054 11:2093354-2093376 TGCAGGGCCCAGCCCCAGGAGGG - Intergenic
1078157077 11:8808262-8808284 AGCAGGACCCAGCAGGATGAGGG + Intronic
1078735548 11:14016854-14016876 TGCAGTGCCCAGCACTTAGTAGG - Intronic
1080760878 11:35247749-35247771 TGCAGTGCCCTGCCCTGTGATGG - Intergenic
1085432759 11:76468854-76468876 TGCAAGTCCCAGCACTCTTAAGG + Intronic
1090448728 11:126787333-126787355 TGCAAGGGCCAGCAATTTGATGG + Intronic
1093612230 12:21175224-21175246 TGCAAGGCATAGCACTATGATGG - Intronic
1094033951 12:26047067-26047089 TGCAGTGCCAAGTTCTATGATGG - Intronic
1096002908 12:48144280-48144302 TGCAGGCCCATGCTCTATGATGG - Intronic
1096363750 12:51010711-51010733 TTCAGGACCCAGCACCATGGTGG + Exonic
1096609993 12:52794973-52794995 TGCCTGGCACAGCAATATGAGGG + Intronic
1097279973 12:57839082-57839104 TGCAGAGGCCAGCCATATGAAGG - Intronic
1097314507 12:58157553-58157575 TCCAGGCCCCAGCACTGGGATGG - Intergenic
1098118748 12:67211495-67211517 TGCAGGGTCAAGCAGTATGCCGG + Intergenic
1100278129 12:93091170-93091192 TGGAGGGACCAGCACTAATAGGG - Intergenic
1101927670 12:108986046-108986068 TGCAGGGCCCAGCACAGGGCTGG + Intronic
1102780831 12:115563183-115563205 CACAGGGCCCTGCACTAGGAAGG + Intergenic
1103991995 12:124805480-124805502 TGCAGGGCCCAGGGCCATGGTGG + Intronic
1107043368 13:35971800-35971822 TCCAGGGCCCAGCATTAACAGGG - Intronic
1107633984 13:42373116-42373138 TACTAGGCCCAGCACTATCATGG - Intergenic
1113069127 13:106402276-106402298 GGAAGTGCCCAGCACAATGACGG - Intergenic
1113856399 13:113448691-113448713 TTCAGGGCCCAGCAGGATGGCGG - Intronic
1114164719 14:20209281-20209303 TTCAGAGACAAGCACTATGACGG + Intergenic
1119705933 14:76782564-76782586 TGCAGGGCCCAACATGATGATGG + Exonic
1120723759 14:87916007-87916029 TGCTGGTCCCAGCCCTCTGATGG + Intronic
1120838022 14:89058342-89058364 TGCCGTGCCCAGCAATTTGAAGG - Intergenic
1121336052 14:93078129-93078151 TCCTGGGCCCAGCACTCGGAGGG + Intronic
1121786607 14:96666209-96666231 TCCAGGGCCCACCACTCAGAAGG - Intergenic
1122098126 14:99386426-99386448 GGCAGGGCCCAGGACCATGTGGG - Intergenic
1128820356 15:70646824-70646846 AGGAGAGCCCAGTACTATGAGGG + Intergenic
1129150541 15:73684992-73685014 TGCAGGGCCCAGCAGGGCGAAGG + Intronic
1130252009 15:82305852-82305874 TGCAGGGGCCATCACAGTGAAGG - Intergenic
1130461821 15:84164773-84164795 GGCAGGGCCCAGCACTCTTGGGG + Intergenic
1131300597 15:91196479-91196501 TGCAGGGCCCAGCACTATGAAGG + Intronic
1131937192 15:97519567-97519589 TTCAAGGCCCAGCTTTATGAGGG + Intergenic
1132591833 16:729467-729489 CGCAGGCCCCAGCCCTGTGAGGG - Exonic
1132751794 16:1461029-1461051 TGCAGGCCCCGGGATTATGAAGG + Intronic
1132796148 16:1724202-1724224 TGCGGGGCCCTGCACTCAGAAGG - Intronic
1133466446 16:6031734-6031756 TTCAGAGCCCAGCAGAATGAGGG + Intronic
1136065096 16:27753418-27753440 TGATGGGCCCAGCGCTGTGAGGG + Intronic
1137292359 16:47060655-47060677 GGCAGGGATCAGCACTATGGTGG + Intergenic
1137349054 16:47694656-47694678 TGCAGGGCCCAGCCCTCTCCTGG + Intronic
1137456302 16:48620666-48620688 TGCAGTCCCCACCACTAGGAAGG + Intergenic
1138871253 16:60889696-60889718 TTCAGAGCTCAGCAGTATGAAGG + Intergenic
1139655311 16:68383819-68383841 TCCAGGGCCCAGAACTATTTGGG - Intronic
1140897135 16:79334657-79334679 TGCAGGGCCCCACACTTAGAAGG - Intergenic
1142526890 17:549113-549135 TGCAGCTCCCAGCACTGTGCTGG + Intronic
1143502282 17:7346550-7346572 GGCAGGGCCCACCACAATGGAGG + Intronic
1144057173 17:11553685-11553707 TTCTGGGCCAAGCACTATGAAGG + Intronic
1144560444 17:16316676-16316698 TCCAGGGCCCTGCACTCAGAAGG + Exonic
1144778288 17:17795719-17795741 TGTAGGGCCCAGCAGGATGACGG - Exonic
1145309502 17:21693664-21693686 TGCAGGGCCAAGCACAGTGTTGG + Intronic
1145971790 17:28960504-28960526 GGCATGGCCCTGCGCTATGAGGG - Exonic
1148122146 17:45219634-45219656 TGCAGGACCAAGCACAGTGATGG + Intergenic
1148159681 17:45442813-45442835 TGCAGGGCCCAGAACTCAAAGGG - Intronic
1148195547 17:45710185-45710207 TGCAGGGCCCACCGTTCTGATGG + Intergenic
1148855738 17:50578420-50578442 TGCAGAGCCCAGCTCTGTGCTGG + Exonic
1149247525 17:54728325-54728347 TGCTGGCCACAGCACTATGATGG - Intergenic
1150297801 17:64023135-64023157 AGCAGGGCCCAGAGCTTTGAAGG + Intergenic
1150390965 17:64789685-64789707 TGCAGGGCCCAGAACTCAAAGGG - Intergenic
1151368167 17:73630494-73630516 CCCAGGGCCTGGCACTATGAGGG + Intronic
1151519452 17:74617737-74617759 TGCAGGGCCCAGGACGAGGTGGG - Intronic
1152271054 17:79325132-79325154 TGCAGGGCCCAGCACATAGCAGG - Intronic
1157913655 18:51643005-51643027 TGCAGGGCCAAGCACTTACAAGG + Intergenic
1161650929 19:5484444-5484466 TGCAGAGCCCAGCCCTCTGGAGG - Intergenic
1163758240 19:19119720-19119742 TCCTGGGCCCAGCAGCATGAGGG - Exonic
1164210852 19:23096200-23096222 TGCTGGGCCCAGCAATGTCACGG - Intronic
1164824502 19:31274549-31274571 TTCAGGGCCCTGCACTGTCAAGG - Intergenic
1166007675 19:39918287-39918309 GGCCAGGCCCAACACTATGAGGG - Exonic
1166595202 19:44041661-44041683 TGAAGGGGCCAGCACGATCATGG + Intergenic
1166947890 19:46408395-46408417 TGCAGCGCCCAGAGCTATGGGGG - Intergenic
1167885043 19:52493313-52493335 AGCAGGGCCCGGCACGAGGAGGG - Intronic
1167909420 19:52689949-52689971 AGCAGGGCCCGGCACGAGGAGGG + Intronic
1167913923 19:52725245-52725267 AGCAGGGCCCGGCACGAGGAGGG + Intronic
1167921433 19:52786247-52786269 AGCAGGGCCCGGCACCAGGAGGG + Intronic
1167946455 19:52992808-52992830 AGCAGGGCCCGGCACGAGGAGGG + Intergenic
1167999383 19:53432467-53432489 AGCAGGGCCCGGCACAAGGAGGG - Intronic
925155044 2:1642540-1642562 AGCAGGGCCCACCACAATGGGGG - Intronic
925794955 2:7531215-7531237 TGCAAGGCCCAACACCATGTGGG + Intergenic
929782600 2:44966703-44966725 TGCAGAGCCCAGCACTTTGCTGG - Intergenic
929937558 2:46304953-46304975 TGCAGGGGCCAACAGTGTGATGG - Intronic
932769634 2:74493231-74493253 TACATGGCCCTGCCCTATGAGGG - Exonic
934929732 2:98412004-98412026 TGCAGAGCTCTGCACTCTGAGGG - Intergenic
937812260 2:126212314-126212336 GGCAGGGCCTACAACTATGATGG - Intergenic
938706974 2:133940284-133940306 TGCAGGCCCCAGGAGTATCATGG - Intergenic
939620605 2:144414398-144414420 CACAGGGCCCAGCACTGAGAAGG - Intronic
940799321 2:158115928-158115950 TGCAGTGCCCAGAAATGTGATGG - Intronic
942778394 2:179612677-179612699 TGCAAGACCCAGCACCATGCTGG - Intronic
944666191 2:201961522-201961544 TGGAGGCCACAGCACTAGGAAGG - Intergenic
946084330 2:217156041-217156063 TGCAGAGCCTAGCTCTTTGAAGG - Intergenic
947585613 2:231354716-231354738 TGCAGGGTCCAGCCCTAGGCAGG + Intronic
947739898 2:232480269-232480291 TGCAGGGCCCAACACTGTGTGGG - Intronic
948660983 2:239506287-239506309 TGCAGGGCCCATGACTGTGGAGG + Intergenic
948787046 2:240358250-240358272 TGCAGGGTCCAGCCCCATGCTGG - Intergenic
948877858 2:240839739-240839761 TCCAGTGCCCCGCACTGTGAGGG + Intergenic
1170157402 20:13281153-13281175 TGCTGTGTCCAGCACTATGCTGG + Intronic
1171266072 20:23773214-23773236 TGCCTAGGCCAGCACTATGAGGG + Intergenic
1172771875 20:37386770-37386792 TGCAGGACCCAGTGCTGTGATGG + Intronic
1172833546 20:37857333-37857355 TGCAGGGCCTAGCAGTCTGCAGG + Intronic
1173189204 20:40863294-40863316 TGCAGGGGCCACTACTAGGATGG + Intergenic
1173516719 20:43669527-43669549 AGCAGAGCCCAGCACGTTGAAGG + Intronic
1174899314 20:54481659-54481681 TGCAGGGCCCAGCACAGAGTGGG + Intronic
1176088017 20:63306875-63306897 AGCAGAGCCCAGCACCCTGAGGG - Intronic
1179010378 21:37551898-37551920 TGCAAGGCCCAGCACTGGGAAGG - Intergenic
1181349064 22:22242566-22242588 TGCAGGGCACAGCAGTTTGATGG - Intergenic
1181520649 22:23447717-23447739 TCCAGGGCACAGCACTGAGATGG - Intergenic
1182143407 22:27982099-27982121 TGCAGAGCACAGCATCATGAGGG + Exonic
1182356175 22:29723157-29723179 TGCAGGGCCCAGGCCCGTGAGGG + Intronic
1183231857 22:36587416-36587438 GGCAGGGCCCACCACCAGGAGGG + Intronic
1183585944 22:38752963-38752985 TGCGGAGCTCAGCACCATGAAGG - Intronic
1183599097 22:38829747-38829769 GGCAGTGCCCAGCACAATGGGGG - Intronic
1183731946 22:39623051-39623073 AGCAGGGGGCAGCACTGTGATGG + Intronic
1184247576 22:43243431-43243453 TGCAGGGCCCAGCCCAAAGCAGG - Intronic
1184332543 22:43835297-43835319 TGCCGTGCCCACCACTGTGACGG + Intronic
1184792696 22:46709570-46709592 TCCAGGTCCCAGCACTCTGCTGG - Intronic
1185132324 22:49046298-49046320 TGCAGGGCCAAGCATTGTGCCGG - Intergenic
949282438 3:2362159-2362181 GGCAGGGCCCAGATCTATCAGGG + Intronic
950574772 3:13825673-13825695 TGCAGGGCCCCACACCCTGAAGG - Intronic
950958001 3:17075610-17075632 TGCAACCCCCAGCACAATGATGG + Intronic
951228466 3:20148405-20148427 TGAAGGGCCAAGCGCTTTGATGG - Exonic
953125566 3:40088728-40088750 TGCAGGGCCCAGCCCCCAGAGGG + Intronic
953262400 3:41352528-41352550 TGCAGTTCCCAGCAATATGAAGG - Intronic
954214559 3:49117157-49117179 GGCAGGGCCCAGCGCCAAGAGGG - Exonic
954417800 3:50402549-50402571 TTCAGAGCCCAGCCATATGAAGG + Intronic
958441607 3:94162635-94162657 TGCTGGTCCCAGCACTAGGCAGG + Intergenic
961387231 3:126529613-126529635 TGCAGGCCCCAGCACAGTGCCGG - Intronic
962212749 3:133492397-133492419 TGCTGGCCACAGCACTGTGATGG - Intergenic
963068275 3:141281239-141281261 TGAAGGGGCCAGCCCTGTGATGG + Intronic
965679275 3:171233727-171233749 TGCTGTGCCAAGCACTATGAAGG - Intronic
965791877 3:172397402-172397424 TGCAAAGCCAAGCACAATGATGG - Exonic
967659820 3:192092585-192092607 TGCAAGACCCAGTGCTATGATGG + Intergenic
968275851 3:197439780-197439802 TGCAGGCCCCACCACTAAGAGGG + Intergenic
968300391 3:197608632-197608654 TGCATGGCTCGGCACAATGAAGG + Intergenic
969244277 4:5922458-5922480 TGCAGGGCCCAGCACCTAGAAGG - Intronic
970446081 4:16124371-16124393 TTCAGGGCCCAGCAGGATGGGGG - Intergenic
970768985 4:19587182-19587204 TGCAGTTCCCAGCACTAGGTTGG - Intergenic
971299277 4:25428511-25428533 TGCAGGGCCCCGGGCTTTGAGGG + Intergenic
976730494 4:88256255-88256277 CACAGGGCCCAGCACTTGGAAGG + Intergenic
981645141 4:146990876-146990898 TGCTGGCCACAGCACTTTGATGG + Intergenic
985201646 4:187490372-187490394 TGCAGGGCCTAACACAATGCTGG + Intergenic
986823174 5:11491491-11491513 TCCAGGTCCCAGCACTAGGAAGG + Intronic
988544755 5:32145020-32145042 TGGAGGGCCCAGGATTAGGAAGG + Intronic
989002266 5:36773657-36773679 TCCAGGCTCCAGAACTATGAGGG + Intergenic
989584079 5:43060926-43060948 GGCAGGGCACAGTCCTATGAAGG - Intergenic
992197609 5:74355209-74355231 GCCAGGGCCCAGCACTAACAGGG + Intergenic
996410221 5:123151083-123151105 TACAGGGCCCAGCACATAGAAGG - Intronic
997183514 5:131858049-131858071 TGCTGGCCACAGCACTGTGATGG - Intronic
997617250 5:135255990-135256012 TGCAAGGCCCAGCATTCAGAAGG - Intronic
999998454 5:157114768-157114790 ACCAGGTCCCAGCACTAAGAGGG + Intronic
1000120919 5:158197119-158197141 TGTAGGGGCCATGACTATGATGG + Intergenic
1001463915 5:171945122-171945144 TACAGTGCTAAGCACTATGAAGG + Intronic
1001832446 5:174800736-174800758 TGCCTGGCCAAGCACTAAGAGGG + Intergenic
1003306139 6:4931345-4931367 GGCAGGGACCAGCATTAGGATGG + Intronic
1006980551 6:38144488-38144510 TGCTGGGCGCAGCACAGTGATGG - Intronic
1014269653 6:119322327-119322349 AGCAGGGCCCAGTACTGAGAGGG - Intronic
1016314010 6:142766569-142766591 TGCATTTCCCATCACTATGATGG - Intronic
1016474942 6:144416856-144416878 TGCAGGGCCAAGCACAAAGGAGG + Intronic
1016907790 6:149168938-149168960 AGGAGGGCACAGCACCATGAGGG + Intergenic
1018908502 6:168088743-168088765 TGCAGGGGACAGCAGTAAGAGGG - Intergenic
1019590593 7:1828530-1828552 TCCAGGGCACAGCACTGAGATGG + Intronic
1019832755 7:3349501-3349523 TGCGGGGACCAGCCCTGTGAGGG + Intronic
1023256496 7:38317913-38317935 TGGAGGGCCCAGCCTCATGAAGG - Intergenic
1023980749 7:45068658-45068680 AGCAGTGCCCAGCACTGTGCTGG - Intronic
1024338603 7:48234769-48234791 TGCAGGTCCAAGAACTATGCGGG + Intronic
1025262415 7:57427538-57427560 TGCGGGGTCCAGCTCTATGTGGG - Intergenic
1026227521 7:68455705-68455727 TTCTGAGCCCAGCACTATGGTGG + Intergenic
1026967804 7:74451440-74451462 TGCAGTGCCCAGCACAAGGCAGG - Intergenic
1030408223 7:109142602-109142624 TGCAAGACCCAGCACTGTGCTGG - Intergenic
1032644457 7:133806996-133807018 TGCAGAGCCCTGCGATATGAGGG - Intronic
1032697339 7:134348744-134348766 TGCAGGTGCCAGCACTGAGATGG - Intergenic
1035547054 8:489718-489740 TGCAGGGCCCCCCACTCTGGAGG - Intergenic
1037379415 8:18268535-18268557 AGCGGGGCACAGCACAATGATGG + Intergenic
1037500622 8:19482318-19482340 TGCAGGGAGCAGCACTGTGCTGG + Intronic
1038799236 8:30734155-30734177 AGCGAGGCCCAGCACAATGAAGG + Intronic
1038804496 8:30778044-30778066 TGCAGGGCCCCACACTTAGAAGG - Intronic
1047924816 8:129672307-129672329 TGCAGAGCCAAGTACTAAGATGG - Intergenic
1049982390 9:916286-916308 TACTGGGCCTAGAACTATGATGG - Intronic
1050451557 9:5786982-5787004 TTCAGGGCCAAGCACTATAAGGG - Exonic
1051501784 9:17786068-17786090 TGCAGGGGCCACCACAGTGAAGG + Intronic
1051911272 9:22155263-22155285 TGCGGGGTCCAGCTCTATGTGGG - Intergenic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1053221246 9:36315171-36315193 TGCATGACCCAGCATTATGTGGG - Intergenic
1057208968 9:93189296-93189318 TGCAGGCCCCAGCACCATCTTGG - Intronic
1058864692 9:109150836-109150858 TCCAGTGCCAAGCACTATGCTGG - Intronic
1059337476 9:113578295-113578317 TCCAGAGCTCAGCACCATGAGGG - Intronic
1059357463 9:113711047-113711069 TCCTGGGCCCAGCATAATGACGG + Intergenic
1060521923 9:124298863-124298885 GGCAGGGCCCAGCATGATCAGGG + Intronic
1061042171 9:128146516-128146538 TTCAGGACTCAGCACTAGGAAGG - Intergenic
1061321476 9:129833365-129833387 TACAGGCCCCAGCTCTCTGAGGG + Intronic
1061913705 9:133738280-133738302 TGCTGGGCCAAGCACTCTTAGGG - Intronic
1062395654 9:136351637-136351659 TGCCTGGCCCAGCACTCTGGAGG + Intronic
1062545685 9:137062892-137062914 TGCGGGGTCCAGCTCTATGTGGG + Exonic
1062607218 9:137353677-137353699 TGCAGGGCCCAGCACAAGCGAGG + Intronic
1186190212 X:7060846-7060868 TGAAGGGACCAGCTCTGTGAGGG + Intronic
1186849399 X:13565736-13565758 CACAGGGCCCAGCACTTTGTAGG + Intergenic
1188004582 X:25008236-25008258 TGCAGGACCCAGTTCTATGCAGG + Intronic
1188144289 X:26590533-26590555 TGCAGAGTGAAGCACTATGAGGG + Intergenic
1188448665 X:30285588-30285610 TGCAGGGCCTGAGACTATGAAGG + Intergenic
1192125286 X:68496122-68496144 ATCTGGGCCCAGCACTTTGAGGG + Intergenic
1197670648 X:129273425-129273447 TGCAGCTCCCAGCTCTAGGAGGG - Intergenic
1198442080 X:136672961-136672983 TCCAGGGCCTAGCACTTTGTAGG + Intronic
1198890653 X:141392111-141392133 TGCTGGTCACAGCACTCTGATGG + Intergenic
1200844528 Y:7818021-7818043 TGCAGATCCCAGCACTTAGATGG - Intergenic
1200891193 Y:8325935-8325957 TGCAGGGCCCAGCACCTAGGTGG + Intergenic
1202252013 Y:22882960-22882982 TGCTGGGCCCAGCACTGAGATGG - Intergenic
1202252348 Y:22886394-22886416 TGCTGAGCCCAGCACCAAGATGG - Intergenic
1202377446 Y:24250377-24250399 GGCAGGGCCCAGCACTCTTGGGG - Intergenic
1202405001 Y:24516709-24516731 TGCTGGGCCCAGCACTGAGATGG - Intergenic
1202405337 Y:24520143-24520165 TGCTGAGCCCAGCACCAAGATGG - Intergenic
1202465443 Y:25149939-25149961 TGCTGAGCCCAGCACCAAGATGG + Intergenic
1202465778 Y:25153373-25153395 TGCTGGGCCCAGCACTGAGATGG + Intergenic
1202493334 Y:25419744-25419766 GGCAGGGCCCAGCACTCTTGGGG + Intergenic