ID: 1131302452

View in Genome Browser
Species Human (GRCh38)
Location 15:91211371-91211393
Sequence TGTGATCCTGAAGACTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131302452_1131302453 -6 Left 1131302452 15:91211371-91211393 CCATGGCAGTCTTCAGGATCACA 0: 1
1: 0
2: 0
3: 10
4: 178
Right 1131302453 15:91211388-91211410 ATCACACTCAATTCTGCCATTGG 0: 1
1: 0
2: 1
3: 6
4: 124
1131302452_1131302454 2 Left 1131302452 15:91211371-91211393 CCATGGCAGTCTTCAGGATCACA 0: 1
1: 0
2: 0
3: 10
4: 178
Right 1131302454 15:91211396-91211418 CAATTCTGCCATTGGCTTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131302452 Original CRISPR TGTGATCCTGAAGACTGCCA TGG (reversed) Intronic
900228331 1:1543264-1543286 CGTGAGCCTGGAGGCTGCCAAGG - Intronic
903379538 1:22887121-22887143 TAGGATCCTGGAGAATGCCAGGG + Intronic
904345264 1:29864011-29864033 AGTAATCTTCAAGACTGCCAAGG + Intergenic
904606579 1:31701193-31701215 TGTGATGCTGAAGACAGTGATGG - Intronic
907810802 1:57867802-57867824 TGTGATGCTGCAGAGTGCCCTGG + Intronic
908754243 1:67453494-67453516 TGTGAACCTAAAGACTACTATGG - Intergenic
911113768 1:94221440-94221462 TGTGATACTGAATACTGTGATGG + Intronic
911293665 1:96087336-96087358 TGTGTTCCTGAAAACCTCCATGG + Intergenic
913398229 1:118396795-118396817 GGTGGCTCTGAAGACTGCCAAGG + Intergenic
916170184 1:161995990-161996012 TGTGTTTCTGCAGACTGCCTTGG - Intronic
919550475 1:198979416-198979438 AGTGATCCAGAAGTCTGCCTAGG - Intergenic
920322751 1:205137176-205137198 TGTGGGCCAGAACACTGCCATGG - Intergenic
922060810 1:222089477-222089499 TGTGCTCCGGAAGGCTACCAGGG - Intergenic
924590829 1:245402699-245402721 TGTCATACTGAAGGCTGCCTTGG + Intronic
924891980 1:248293094-248293116 TGTCATCCTCAAGTCTTCCAAGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064561714 10:16600328-16600350 AATGATCCTGGAGACTGCCTGGG + Intronic
1066589000 10:36971831-36971853 TGGGACCCTGAAAACTTCCATGG - Intergenic
1068686520 10:59875720-59875742 TGTGATTCTGGAGAATGCAAAGG + Intronic
1069001262 10:63268957-63268979 TGTAATCCTCATCACTGCCAGGG - Intronic
1071039879 10:81294410-81294432 TGTGTTTCTGAAGACTGCTTTGG + Intergenic
1072049175 10:91686724-91686746 TGTGAACCAGAAGACTGCTCAGG + Intergenic
1072195578 10:93115027-93115049 TGGTATCCTGAAATCTGCCACGG - Intergenic
1074430383 10:113389212-113389234 AGTCATCATAAAGACTGCCATGG - Intergenic
1074485018 10:113867696-113867718 TGAGATCCAGAAGACAACCATGG - Intronic
1076014705 10:127018424-127018446 TGTGCTGCTGAGGAATGCCAAGG - Intronic
1076789389 10:132768614-132768636 TGCTTTCCTGAAGGCTGCCAGGG + Intronic
1077574760 11:3374234-3374256 TGTGATTCTGAAGATTTCAAAGG + Intronic
1077782987 11:5352158-5352180 TTTGATTCTCAAGACTGTCATGG + Exonic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1084508632 11:69587429-69587451 GGGGATCCAGAAGACTGCCTGGG - Intergenic
1085234397 11:75001975-75001997 TTTTATCCAGAAGACTGCGAGGG + Intronic
1088372823 11:109110330-109110352 TTTTATCCTGAAGATTGCCTGGG - Intergenic
1090922699 11:131220770-131220792 TGGGGTCCTGAAGTCTGCCCTGG - Intergenic
1091204190 11:133808361-133808383 TGTGACCCTGAAGCTGGCCATGG + Intergenic
1091235127 11:134016784-134016806 TGTGAGCCTGCATCCTGCCAGGG - Intergenic
1091548930 12:1523370-1523392 TCTGATCCTGAACTCAGCCAGGG - Intergenic
1091896440 12:4109017-4109039 TGTGAACTTGTAGACTCCCAGGG - Intergenic
1096844850 12:54400822-54400844 TGAGATCCTGAACACTGGCATGG - Intronic
1097454036 12:59773951-59773973 GGTGATACTCAACACTGCCAAGG + Intronic
1098162023 12:67654897-67654919 ACTGATCCTGAACACAGCCAGGG - Intronic
1099811387 12:87586908-87586930 TCTGATCATCAAGACTGCTATGG + Intergenic
1101421738 12:104556350-104556372 TGTGATCCTGGAGTTTGGCAGGG + Intronic
1101449105 12:104760337-104760359 TCTAATCCTGGATACTGCCACGG + Exonic
1101554788 12:105798875-105798897 TGTGATCCTGAAGACTCAGTTGG + Intergenic
1102900627 12:116633776-116633798 TGTGAGTCTGAAGTCTGACAAGG + Intergenic
1106303186 13:28487891-28487913 TGTGGTCTTGAAGAATACCATGG - Intronic
1107369239 13:39724540-39724562 TGTGACACTGAAGGCTGCAATGG + Exonic
1109110784 13:58317143-58317165 TGAGACCATGAATACTGCCAAGG + Intergenic
1119178290 14:72586008-72586030 TTTTATTCTGAAGACAGCCAAGG - Intergenic
1119970646 14:78966278-78966300 TGTAAGCCTGAAGAGTGGCAAGG - Exonic
1121020546 14:90577706-90577728 TGTCATCCTGAAGTCTCCCCGGG + Intronic
1121210775 14:92206838-92206860 TGTGAACCTGAAAACTGTCAAGG + Intergenic
1121365461 14:93304974-93304996 TGTCTTCATGAAGACTGCCCTGG - Intronic
1121591900 14:95121166-95121188 TGTACTCCTGAAGACTGTCAAGG + Intronic
1122997849 14:105275243-105275265 TGTGATGCTGCTGACTGCCAGGG - Intronic
1126667194 15:51086239-51086261 TGTGATCCAGAAGAAGCCCACGG + Intronic
1126689831 15:51280590-51280612 TGAGAACCTGGAGCCTGCCAAGG - Intronic
1127930082 15:63589795-63589817 TGTGTTTCTAAAGACTGCCATGG + Intronic
1129524330 15:76204369-76204391 TGGGACCCTGGAGGCTGCCAAGG + Exonic
1131302452 15:91211371-91211393 TGTGATCCTGAAGACTGCCATGG - Intronic
1131405418 15:92160455-92160477 TGTGATCCCAAAGGCTGCCCAGG - Intronic
1131865745 15:96707522-96707544 TTTCAACCTGAAGACTCCCAAGG + Intergenic
1132507130 16:316655-316677 TGTGAGGCTGACGACTGTCAGGG - Intronic
1132507137 16:316697-316719 TGTGAGGCTGACGACTGTCAGGG - Intronic
1138274560 16:55724292-55724314 TGTGATAGTAAAGACAGCCATGG - Intergenic
1140698256 16:77556541-77556563 TGTACTCCTTAAGACTGTCAAGG + Intergenic
1140773630 16:78229000-78229022 TGTTATCCTGAATTATGCCAGGG + Intronic
1141511245 16:84513674-84513696 TGTTATCCGAAAGACCGCCAGGG - Intronic
1141790395 16:86230418-86230440 TGTCATCCAGAAGACTGCTTGGG - Intergenic
1144085857 17:11807839-11807861 TGTGATCTGGAAGACATCCATGG - Exonic
1144149811 17:12432617-12432639 TGTATTCCTGGAGACTGGCAAGG - Intergenic
1149097380 17:52859737-52859759 TGTGATCCAGCAAATTGCCATGG - Intergenic
1151507633 17:74539920-74539942 TGTCATCCTGGGGTCTGCCAAGG + Intergenic
1155351396 18:24911005-24911027 TGTGCACCTAAAAACTGCCAAGG - Intergenic
1156322671 18:36041950-36041972 TGTGAACCTGAACTCTCCCAAGG - Intronic
1159322753 18:66875300-66875322 TGTAAACCTGAACACAGCCATGG - Intergenic
1161041023 19:2110863-2110885 TGTCCTCCTGCAGACTGCCCCGG + Exonic
1161515269 19:4692949-4692971 GGTGATGCTGTAGGCTGCCACGG - Intronic
1164633347 19:29775772-29775794 TCTGCTCCTGAAGGCTTCCATGG + Intergenic
1166227173 19:41403511-41403533 TGGGACCCTGAAGACTGGCATGG - Intronic
926405598 2:12549290-12549312 TGTGACCATGAAGGCTGTCAGGG - Intergenic
930726129 2:54683260-54683282 TTTGATTCTGAAGATTGCGATGG + Intergenic
932005301 2:67921530-67921552 TGTGATCATGAAATATGCCAAGG - Intergenic
940540225 2:155005490-155005512 TCTGTTCCTCAAGACAGCCATGG + Intergenic
942263669 2:174198464-174198486 TTTGACCTTGAAGACTCCCAGGG - Intronic
942590348 2:177538126-177538148 TGGGATGCTGAAGTCTGTCAAGG + Exonic
942868792 2:180709545-180709567 TGAGAGACTGAGGACTGCCAAGG + Intergenic
943190097 2:184665283-184665305 TGTGATCATGAAGATGCCCATGG + Intronic
945069767 2:205978127-205978149 TGTGAAGCTGCAGACTGTCACGG - Intergenic
1169021743 20:2335664-2335686 TGTGATTCTCAAGCCTGGCATGG - Intronic
1169276357 20:4235970-4235992 GGGGATCTTGAGGACTGCCATGG - Intronic
1170843744 20:19944970-19944992 AGTCATCCTGAAAACTCCCATGG + Intronic
1171103097 20:22404627-22404649 TTTGATCCTGCAGCCTGTCAGGG + Intergenic
1171136687 20:22701204-22701226 CTTGATCCTGAAGCCTCCCATGG + Intergenic
1177235512 21:18385006-18385028 TGTGAAACTGAATAGTGCCATGG - Intronic
1177890743 21:26800995-26801017 TGTGATCCTGCAGACAGACGAGG - Intergenic
1179940559 21:44636882-44636904 TGAGATCCTGATGTCTGCCAAGG - Intronic
1180167271 21:46036653-46036675 TGAGATACTGATGGCTGCCAGGG + Intergenic
1181306885 22:21921991-21922013 TGTGATGCTGAACACCCCCAAGG - Exonic
1182257882 22:29051063-29051085 TCTGAGGCTGAAGACTTCCAAGG + Intronic
1184520196 22:44989132-44989154 TGTGATCCGCCAGCCTGCCATGG - Intronic
950204117 3:11064857-11064879 TGAGATGGTGAATACTGCCAAGG - Intergenic
954165306 3:48752340-48752362 TGTGATCCTGGAGTCAGCCTAGG - Intronic
954508140 3:51097147-51097169 TGTGAATCTGAAGACAGCAACGG - Intronic
960432814 3:117590569-117590591 TGTGTTCCTTAAGATTGTCAAGG - Intergenic
965469331 3:169071334-169071356 TCTGATCATGAAGACAGCCTAGG - Intergenic
966504680 3:180686240-180686262 AGTGCTCCTGAATACTGTCAAGG - Intronic
969253760 4:5989023-5989045 TCTGACCTTGAAGACTGCAATGG - Exonic
969496634 4:7530001-7530023 TGTGACCCTGAGGACTGTGAGGG + Intronic
970384990 4:15546965-15546987 TGTTATCCCGAAGAAAGCCATGG + Intronic
971210854 4:24614828-24614850 TGTGAGGCAGAAGACTGACAGGG - Intergenic
974781089 4:66553740-66553762 TATGATCCTGAAAACTCTCATGG - Intergenic
975650579 4:76588913-76588935 TGTGATCATTAAGACTGCTGGGG - Intronic
976343944 4:83978205-83978227 CGTGAAGCTGAAGACTGCCTGGG + Intergenic
978218905 4:106245212-106245234 TGTGAGTCTGGAGACTGACAAGG + Intronic
982067810 4:151670021-151670043 TGTGAACCTGTAGCCTACCAAGG - Intergenic
982385932 4:154802418-154802440 AGTGATCCAGAACACTGCTATGG - Intronic
985533417 5:447240-447262 GGTGATCCTGGACACTACCACGG - Intronic
987969856 5:24928650-24928672 TGTCATCTTGAAGTCAGCCATGG + Intergenic
988906490 5:35796021-35796043 TGTGATCCTGGAAAATTCCATGG + Intronic
990442740 5:55862826-55862848 AGTACTCCTTAAGACTGCCACGG - Intronic
993811791 5:92488697-92488719 AGTAATCCTCAAGACTGTCAAGG + Intergenic
995118992 5:108516014-108516036 AGTGATTCTGAAGACTGTTATGG + Intergenic
995589015 5:113679126-113679148 TGTTACCGTGAAGACTGCCAGGG + Intergenic
998439494 5:142145180-142145202 TGTCAACCTGAAGAAAGCCATGG - Intronic
999888663 5:155952560-155952582 TGTGATGCTGAAAACAGTCATGG + Intronic
1000506542 5:162127063-162127085 TTTCATCCTTAAGAGTGCCACGG - Intronic
1001000328 5:167999888-167999910 TGTGCACCTCAAGAATGCCAAGG + Intronic
1001066368 5:168537958-168537980 GGTCCTCCTGAGGACTGCCAGGG + Intergenic
1001313724 5:170628590-170628612 TGTGATCCAGAAGGCGGCCTTGG + Intronic
1001663234 5:173412347-173412369 TGTCATTCTGAAGACTCCAAGGG - Intergenic
1006429553 6:33987378-33987400 TGTGATGGTGAAGAACGCCATGG + Intergenic
1007896789 6:45370367-45370389 TGAGATCCAGAAGACTGGGAAGG + Intronic
1016540211 6:145156292-145156314 TGTTAGCTTGAAGACAGCCAAGG - Intergenic
1017021919 6:150146828-150146850 TGTCTTCCTGAAGACTTCCTAGG - Intronic
1017692631 6:156982357-156982379 TGTGATCCTGGAAACTGTTAGGG + Intronic
1018708412 6:166479407-166479429 TGTGGTCCTGCAATCTGCCAGGG + Intronic
1019802366 7:3097563-3097585 TGTGATCCAGGAGAATTCCAGGG - Intergenic
1020101305 7:5395540-5395562 TGTGACCCAGAGGCCTGCCAGGG - Intronic
1020254384 7:6494517-6494539 TGTTGTCTTGAAGACTGACAAGG + Intergenic
1021635709 7:22690414-22690436 GCTGCTCCTGAAGACTGCTAGGG + Intergenic
1023504958 7:40889513-40889535 TCTGATTCTGAAGACAGCTAAGG - Intergenic
1023708758 7:42969597-42969619 TGTGATTATGAAGGCTGGCAAGG - Intergenic
1024268352 7:47623598-47623620 TGTGCTCCATAGGACTGCCACGG + Intergenic
1024421383 7:49170963-49170985 TGAGATGCTGAATACTGCCACGG - Intergenic
1024960320 7:54967891-54967913 TGTGACACAGTAGACTGCCATGG + Intergenic
1025620539 7:63166252-63166274 TGTGATTTTGAATATTGCCATGG + Intergenic
1026284538 7:68951635-68951657 TGTGATCCACAAAAATGCCAAGG + Intergenic
1026807114 7:73435524-73435546 TTTGAGCATGAAGACCGCCACGG - Exonic
1032405883 7:131655091-131655113 TGTCATCCTCACGACTGCCCTGG - Intergenic
1032566754 7:132954585-132954607 TGAGATGCTGAAGACAGCCCAGG - Intronic
1033483448 7:141764307-141764329 AATGATCCTCAAGAGTGCCAGGG - Exonic
1034947442 7:155272107-155272129 TGTCCTCCTGAAAACTGCCAAGG + Intergenic
1035175241 7:157045564-157045586 TGTGATCCGGCAGCCTGTCAGGG + Intergenic
1035737013 8:1896391-1896413 TGTTTTCTTGAGGACTGCCACGG - Exonic
1035910400 8:3559282-3559304 TGTGAACATGAAGATCGCCATGG + Intronic
1037976932 8:23220443-23220465 TTGGAGGCTGAAGACTGCCAGGG + Intronic
1039249749 8:35649795-35649817 AGTGCTCCTCAAGCCTGCCAAGG + Intronic
1039478027 8:37851477-37851499 TATGATCCTGCAGCCAGCCACGG + Intergenic
1039947705 8:42144246-42144268 TGTGATCTTCAAGAATGTCAAGG - Intergenic
1041026033 8:53688088-53688110 TGGCATCCTGTAGACTGGCATGG - Intergenic
1041757948 8:61334508-61334530 TATGATCCTGAAAACAGCAAAGG - Intronic
1043749100 8:83912697-83912719 CGTGATCGTGGAGACTGCGAAGG - Intergenic
1046855901 8:119031581-119031603 TGTGATGCTGATGATTGGCAAGG + Intronic
1047752783 8:127894434-127894456 TGAGATCCAGAAAGCTGCCACGG + Intergenic
1048559208 8:135514805-135514827 TGAGATCCTGAGGACTGAAATGG - Intronic
1048952119 8:139504994-139505016 TGTGCTCCTTAAGAAAGCCAGGG + Intergenic
1051155417 9:14139124-14139146 TGTTATCCTGCAGCCTGCCTAGG - Intronic
1053144623 9:35704149-35704171 GGGCATCCTGAAGACTGCGAAGG - Exonic
1055483722 9:76735576-76735598 AGTGATCCTAAAGTCTTCCATGG - Intronic
1056112295 9:83407988-83408010 TGGCTTCCTGGAGACTGCCATGG - Intronic
1056824431 9:89866739-89866761 TGGGGTCCTGAAGACTGCTCAGG + Intergenic
1058961256 9:109994817-109994839 TCTGATCCTGAGCCCTGCCATGG + Intronic
1060423092 9:123483403-123483425 TGAGTTCCTGGAGGCTGCCATGG - Intronic
1185465633 X:352889-352911 TGTGACCCTGAAGACTCCTCCGG - Intronic
1185582711 X:1223378-1223400 TGTGATTCTGAGGGCTGACAGGG + Intergenic
1187437914 X:19289593-19289615 TGTCCTTCTGAAGACTTCCAGGG - Intergenic
1190626576 X:52343477-52343499 TGTGCTCCTGATGCCAGCCATGG + Intergenic
1190701434 X:52992352-52992374 TGTGCTCCTGACGCCAGCCATGG - Intronic
1191740232 X:64428664-64428686 TGTGAAGCTGACAACTGCCAGGG + Intergenic
1192891048 X:75390568-75390590 TAAGATCCTGAAGAATTCCATGG - Intronic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1195294971 X:103467172-103467194 TGTACTCCTCAAGACTGTCAAGG - Intergenic
1195301199 X:103531366-103531388 TGTACTCCTCAAGACTGTCAGGG + Intergenic
1195420654 X:104671746-104671768 TCTGCTCCTAAAGACTGCTAGGG - Intronic
1198314774 X:135454419-135454441 ATTCATCCTGCAGACTGCCATGG + Intergenic