ID: 1131302571

View in Genome Browser
Species Human (GRCh38)
Location 15:91212401-91212423
Sequence ACACAGGGACTTTAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131302571_1131302581 22 Left 1131302571 15:91212401-91212423 CCTTCCCACTAAAGTCCCTGTGT 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1131302581 15:91212446-91212468 CCCATGTGAGTCCCATCATTAGG 0: 1
1: 0
2: 0
3: 5
4: 102
1131302571_1131302576 -3 Left 1131302571 15:91212401-91212423 CCTTCCCACTAAAGTCCCTGTGT 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1131302576 15:91212421-91212443 TGTGCTCCTGCTAGAGTCACTGG 0: 1
1: 0
2: 3
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131302571 Original CRISPR ACACAGGGACTTTAGTGGGA AGG (reversed) Intronic
903737029 1:25536412-25536434 ACACAGGAAGTTTAGGGGAAGGG + Intergenic
906801892 1:48745186-48745208 AGAGAGGGACTTTAATGGGCTGG + Intronic
906884087 1:49625798-49625820 AAGCAGGCACTTTAGTGGTAGGG - Intronic
907077071 1:51588541-51588563 ACTCAGGGGCTGAAGTGGGATGG + Intronic
911892024 1:103383165-103383187 ACACTGGGACTGTTGTGGGGTGG + Intergenic
912526793 1:110289584-110289606 ACACATGGCCTTCAATGGGATGG + Intergenic
916157197 1:161864676-161864698 ACACAGGGAATTTTGTGAAAAGG - Intronic
917966160 1:180179968-180179990 ACTCAAGGACTGTGGTGGGAGGG - Intronic
918307580 1:183261103-183261125 GCAAAAGGAGTTTAGTGGGAGGG - Intronic
918643881 1:186879995-186880017 ACACAGGGCCTGTTGTGGGGTGG - Intronic
921120796 1:212135160-212135182 ACACAGGGATCCTTGTGGGAAGG + Intergenic
921844026 1:219860220-219860242 CCAGAGGGACTGTAGTGGTAGGG - Intronic
923312297 1:232746923-232746945 TAACAGGGAGGTTAGTGGGATGG - Intergenic
1062908218 10:1193438-1193460 ACAAAGGGACTTTGGGGGAATGG + Intronic
1063584507 10:7339660-7339682 TCACAGGGACTGAAGTGGGCTGG + Intronic
1066185976 10:33010776-33010798 ACTCAGGGAGTTCAGAGGGATGG + Intergenic
1069159228 10:65071666-65071688 ACACCGGGACTGTTGTGGGGTGG - Intergenic
1071007294 10:80897214-80897236 AAACAGGGATTTTACTGGGCTGG - Intergenic
1071392500 10:85189920-85189942 CCAGAGGGACTTTACTGAGAGGG + Intergenic
1072715311 10:97748240-97748262 ACACAGGGGCTTTGGTGAGTGGG - Intronic
1072936517 10:99718484-99718506 ATACAGGGGCTTTTGTGGCAGGG - Exonic
1076495418 10:130894020-130894042 ACGCAGGGTCTTTGGTGGCAAGG + Intergenic
1076570295 10:131428262-131428284 ACAAAGGGTCTGTAGTGAGAGGG + Intergenic
1077499934 11:2904740-2904762 GCACAGGGGCTGCAGTGGGAAGG + Intronic
1077798597 11:5516436-5516458 CCACATGGGCTTTAGTGGGTGGG + Exonic
1079683489 11:23326946-23326968 ACACCGGGACTGTCGTGGGGTGG + Intergenic
1080304870 11:30825483-30825505 CCACAGGAACATCAGTGGGAAGG + Intergenic
1083001683 11:59298009-59298031 CCAGAGGGACTTTACTGAGAGGG + Intergenic
1083909579 11:65698363-65698385 AGTCAGGGACTGGAGTGGGAGGG - Intergenic
1085642618 11:78202169-78202191 ACAAAGGGACTTGAGTTGGTAGG + Intronic
1087153199 11:94877130-94877152 AAAGCGGGACTTTGGTGGGAAGG + Intergenic
1087991620 11:104750477-104750499 ACACAGTGACTTTTTTGAGAAGG - Intergenic
1088426396 11:109709476-109709498 AAACAGGGAGGTTAGTGGAAGGG + Intergenic
1090498867 11:127242131-127242153 GCACTGGGACTCTAGTGGAAAGG + Intergenic
1094399876 12:30050952-30050974 ACCCAGGGCCTTTACTAGGAGGG - Intergenic
1095293812 12:40506127-40506149 ACACAGGTAGTTGAATGGGAAGG + Intronic
1095294118 12:40509082-40509104 ACACAGGTAGTTGAATGGGAAGG + Intronic
1095814259 12:46404247-46404269 ACACAGAGACTTTTGTAGGCAGG + Intergenic
1096457342 12:51798618-51798640 ACAAAGTGACTATAGTGGCAGGG - Intronic
1097240949 12:57574968-57574990 ACGCAGGGACTCAAATGGGATGG - Intronic
1101295456 12:103419149-103419171 CCACAGGGAGTTCAGTGAGATGG + Intronic
1102128197 12:110502516-110502538 TAACAGGGACTTGAGTGGGTGGG - Intronic
1106006553 13:25775447-25775469 ACACTGGTACTTACGTGGGAAGG + Intronic
1106136523 13:26977708-26977730 CCACAGGGCCGTTCGTGGGATGG + Intergenic
1107568771 13:41633974-41633996 ACAAAGGGAGATAAGTGGGAGGG - Intronic
1107976478 13:45693309-45693331 ACAGAGGGACTTCAATGGGGTGG + Intergenic
1111367830 13:87273053-87273075 ACACATGTCCTTTAGTGGGCTGG + Intergenic
1114930766 14:27465198-27465220 ACTCAGTGATTTTAGTGGGCAGG + Intergenic
1115521700 14:34239462-34239484 ACAAAGGGACTCTAGAAGGATGG - Intronic
1119100254 14:71872798-71872820 ACACGGGGCCTGTCGTGGGATGG - Intergenic
1119446957 14:74673046-74673068 ACACAGGGATTCTATAGGGAAGG - Intronic
1119748172 14:77059224-77059246 GGACAGGGGCTTTAGGGGGAGGG - Intergenic
1120292852 14:82598735-82598757 ACAGAGGGATTATAATGGGAAGG + Intergenic
1121553941 14:94822326-94822348 AGACATGGAGTTTAGAGGGAAGG + Intergenic
1121779609 14:96613865-96613887 CCACAGGGTCGTTAGTGGGTTGG + Intergenic
1121977925 14:98422992-98423014 GGACAGAGACTTTAGTGGCAAGG + Intergenic
1122078135 14:99248520-99248542 ACACAGGGACATTAGGGACAGGG + Intronic
1122509102 14:102251408-102251430 ACACAGGTAGTTTAGTGGCTTGG + Intronic
1124927473 15:34084902-34084924 ACACAGGGCCTGTTGTGGGGTGG - Intronic
1130619267 15:85444683-85444705 CCACAGAGGCTTTTGTGGGAAGG + Intronic
1131302571 15:91212401-91212423 ACACAGGGACTTTAGTGGGAAGG - Intronic
1131714098 15:95089886-95089908 ACACAGGAATTTGAGGGGGAAGG - Intergenic
1132243100 15:100275985-100276007 CCACAGAGACCTAAGTGGGAGGG + Intronic
1134856004 16:17519753-17519775 AGACAGGGATTTTATTTGGATGG + Intergenic
1139378065 16:66513245-66513267 ACGCAGAGACATTAGTGGGCAGG + Intronic
1140559566 16:75962390-75962412 ACACAGGAACTTTAGTGCTATGG + Intergenic
1141375692 16:83527990-83528012 ACGCAGGGAGTTTATCGGGAAGG + Intronic
1142266697 16:89067215-89067237 ACACAGGGGCTTAGGTGGGCAGG - Intergenic
1146144720 17:30403447-30403469 AGACAGAGACTTTAGTGAGATGG - Intronic
1147584892 17:41648422-41648444 ACAGAGGGACTTGAGCGGGTGGG - Intergenic
1149216828 17:54366085-54366107 ACACAGGAATTTTGGTGGCAGGG - Intergenic
1151490209 17:74428288-74428310 ACAATGGGTCTTTCGTGGGAAGG + Intronic
1151584694 17:75002021-75002043 ACACAGGGACTTTAAGGGGATGG - Intronic
1151958592 17:77393095-77393117 AGACAGGGATTTCAGTGGGAGGG + Intronic
1152784134 17:82239286-82239308 ACAACGTGACTTTAATGGGAGGG + Exonic
1153969591 18:10213975-10213997 CCACAGGTACTTTTTTGGGAAGG - Intergenic
1154254628 18:12771736-12771758 ACAAAGGGACATTTCTGGGATGG - Intergenic
1158158894 18:54457518-54457540 GCTCAGGGATTTTTGTGGGATGG + Intergenic
1166901028 19:46063004-46063026 AGAGAGGGACTTTACTGAGAGGG + Intronic
930421346 2:51156954-51156976 ACAGAGGAAATATAGTGGGAAGG + Intergenic
932450151 2:71804522-71804544 ACAAAGTGATTTGAGTGGGAGGG + Intergenic
933258388 2:80106094-80106116 ACACAGGGCTTTTATTGGGCTGG + Intronic
934678826 2:96267934-96267956 AAGCAGGGACTCTTGTGGGAAGG + Intronic
936244546 2:110815510-110815532 ATACAGGGACCTTAGAAGGAGGG + Intronic
936701614 2:115017838-115017860 ACACAGGGCCTGTTGTGGGGTGG + Intronic
936785323 2:116087663-116087685 ACACTGGGGCTTTTGTGGGAAGG + Intergenic
937549691 2:123072407-123072429 ACACAGGAGGTTTAATGGGAAGG - Intergenic
938596420 2:132791904-132791926 ACACATGGACATGAGTGGGCAGG - Intronic
938596505 2:132792861-132792883 ACACATGGACATGAGTGGGCAGG - Intronic
941274243 2:163470701-163470723 AGAAAGGGACTTCAGTGGCAAGG + Intergenic
943466549 2:188235837-188235859 ACAGAGGGACTTTACTGAGAGGG - Intergenic
944192746 2:197020954-197020976 ACACTGGGCCTGTCGTGGGATGG - Intronic
1170223823 20:13969051-13969073 ACACAGTGACTTTAGTTGAAAGG + Intronic
1170765268 20:19284561-19284583 ACACAGGGACTTGAGTGTTTGGG + Intronic
1171557896 20:26094994-26095016 ATACAGGTACTTTGATGGGAAGG + Intergenic
1171865334 20:30484759-30484781 ACACAGGGCCTGTTGGGGGAGGG + Intergenic
1174177006 20:48651561-48651583 ACCCAGGGACAGCAGTGGGAAGG + Exonic
1174961575 20:55163163-55163185 ACACAGAGACTTCAACGGGAAGG - Intergenic
1174968700 20:55249223-55249245 ACACTGGGCCTGTTGTGGGAAGG + Intergenic
1175915413 20:62423655-62423677 CCACAGTGACTTCACTGGGAAGG - Intronic
1176050918 20:63119365-63119387 ACACAGGGGCTTTGCTGGGCTGG + Intergenic
1177091367 21:16772929-16772951 ACACAGGGTATACAGTGGGATGG - Intergenic
1178244361 21:30936602-30936624 ACACAGGCTCTTGGGTGGGAAGG + Intergenic
1180070291 21:45432432-45432454 GCACAGGGCCTGGAGTGGGATGG + Intronic
1180798723 22:18621306-18621328 ACATGGGGAGTGTAGTGGGAGGG + Intergenic
1181222991 22:21373956-21373978 ACATGGGGAGTGTAGTGGGAGGG - Intergenic
1181255748 22:21561663-21561685 ACATGGGGAGTGTAGTGGGAGGG + Intronic
1181296456 22:21843894-21843916 ACGAAGGGATTTTAATGGGATGG - Intronic
1183599965 22:38834292-38834314 GGACAGGGACTTTATTGGCAGGG - Intronic
1184492262 22:44816428-44816450 ACACAGGGACAAGGGTGGGACGG - Intronic
1184680333 22:46069675-46069697 ACACACGGAATTTGGGGGGAGGG - Intronic
950227930 3:11251105-11251127 AAACAGGGACTGTAGCTGGAGGG + Intronic
954716618 3:52529999-52530021 GCTCAGGAACATTAGTGGGAGGG + Intronic
955233897 3:57123084-57123106 TCACAGAGACTTTATTTGGAGGG - Intronic
958704302 3:97634514-97634536 ACGCAGGAACTTTGTTGGGAGGG + Intronic
960125371 3:113992562-113992584 AAACGGGGACTGTTGTGGGATGG + Intronic
963390052 3:144649918-144649940 AAACAGTAACTCTAGTGGGAGGG - Intergenic
965885854 3:173446221-173446243 ACACCGGGACTGTTGTGGGGTGG - Intronic
966804519 3:183796352-183796374 AAAAAGGGCCTTTAGTGTGAAGG - Intronic
967195704 3:187023719-187023741 ACACCGGGACTGTTGTGGGGTGG + Intronic
967941839 3:194772339-194772361 TCCCAGGGACATTATTGGGAGGG + Intergenic
971541056 4:27817282-27817304 AAACAGGGACATTAGAGGCAGGG + Intergenic
973739591 4:53906647-53906669 ACACTGGGAAGTTAGAGGGAAGG - Intronic
976563300 4:86526194-86526216 ATCCAGGGATTTTAGGGGGATGG + Intronic
976700043 4:87959912-87959934 CCACAGGGACTTTACTGAGAGGG - Intergenic
978272103 4:106903327-106903349 ACACAGGGCCTTTTGTGGGGTGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979975982 4:127196851-127196873 ACACAGAGCCTTTGCTGGGATGG - Intergenic
980473016 4:133273954-133273976 ACACAGGGGCCTTTGTGGGTGGG - Intergenic
981059647 4:140408967-140408989 ACACAGGGGATTTGCTGGGATGG + Intronic
981220389 4:142225612-142225634 ATACAAGGACTTTAGAGGAAAGG - Intronic
982019989 4:151193618-151193640 ACACAGTGACTTTACTAAGATGG + Intronic
986106967 5:4668752-4668774 ACACAGTGACTTTACTGCAAGGG - Intergenic
986222705 5:5783823-5783845 ACACAGGGCCTGTTGTGGGGTGG + Intergenic
986985694 5:13499046-13499068 ACACAGGAACTTGAGTGTGGTGG - Intergenic
988631521 5:32936634-32936656 ACACATGGGTTTTAATGGGAAGG + Intergenic
991363750 5:65847043-65847065 ACACTGGGACTTTTGTGGGGCGG - Intronic
991718674 5:69475841-69475863 TCACAGAGACTAGAGTGGGAGGG - Intergenic
991719281 5:69480531-69480553 TCACAGAGACTAGAGTGGGAGGG + Intergenic
997088732 5:130831440-130831462 ACAGGAGGACTTTAGTGGGGAGG + Intergenic
998079542 5:139263038-139263060 ACCTAGGGATTTTAGGGGGATGG + Intronic
999586907 5:153099518-153099540 ACACACGCACCTCAGTGGGAGGG - Intergenic
1000994383 5:167944265-167944287 AGGCAGGGACATTTGTGGGAGGG - Intronic
1001081559 5:168671344-168671366 CCCCAGGGACTGTGGTGGGAGGG + Exonic
1003623077 6:7719413-7719435 ACAGAGGGAATCTTGTGGGAAGG + Intergenic
1004326962 6:14683866-14683888 ACACACGGACTCTAGTGGGTTGG - Intergenic
1011767534 6:90639174-90639196 ATCCATGGACTTTAGTTGGATGG + Intergenic
1012018224 6:93880829-93880851 ACACAGGGCCTGTTGTGGGGTGG - Intergenic
1012288697 6:97424105-97424127 ACACAGTGACCATAGTGGAAGGG - Intergenic
1013906683 6:115228044-115228066 ACACAGGGACTGTTGTTGGGTGG + Intergenic
1015446847 6:133316063-133316085 ACACAGGGACATCAATGAGAAGG - Intronic
1016092435 6:139996384-139996406 TTTCAGGGACTTGAGTGGGAGGG - Intergenic
1016295797 6:142572648-142572670 TTACAGGGACTTTACTGAGAGGG - Intergenic
1018311007 6:162508608-162508630 ACACTGGGTCTTTAGAGAGATGG - Intronic
1020411014 7:7891637-7891659 TACCAAGGACTTTAGTGGGAGGG + Intronic
1022809732 7:33857049-33857071 ACCCAGTGACTTAAGTGGGATGG + Intergenic
1023313664 7:38913335-38913357 ACACAGGCACAAGAGTGGGAAGG + Intronic
1024417969 7:49130033-49130055 GCACAGGGACCAGAGTGGGAAGG - Intergenic
1025719350 7:63995961-63995983 TCAGAGGGACTTTACTGAGAGGG + Intergenic
1026136111 7:67662490-67662512 ACACAGGGACAATATTGTGAGGG - Intergenic
1026285942 7:68962847-68962869 TCACATGGACTATAGTGTGAAGG + Intergenic
1026299911 7:69088927-69088949 ACACAGGGCTTTTATTGGGATGG + Intergenic
1026505115 7:70976060-70976082 AGACAGGGACTTTTCTGGGAGGG + Intergenic
1027550442 7:79586516-79586538 ACACAGGGCCTGTTGTGGGGTGG + Intergenic
1028012290 7:85662107-85662129 ACACCGGGCCTGTCGTGGGAGGG - Intergenic
1028065787 7:86381451-86381473 ACACAGGGTCTGTTGTGGGGTGG + Intergenic
1028650904 7:93149770-93149792 AGAGAGGGACTTTACTGAGAGGG - Intergenic
1033222722 7:139539452-139539474 ATACATGGACTTTTCTGGGAAGG - Intronic
1034297467 7:149986996-149987018 ACTCAGTGTCTTTAGTGGGTGGG - Intergenic
1034808558 7:154109858-154109880 ACTCAGTGTCTTTAGTGGGTGGG + Intronic
1035198251 7:157241025-157241047 AGCCAGGGATTTTAGCGGGAGGG + Intronic
1035370996 7:158378894-158378916 TCAAGGGGACTTTAATGGGATGG + Intronic
1036706087 8:11048397-11048419 GCACAGGGACTCTGGTGGGCGGG - Intronic
1037181242 8:16007827-16007849 ACAAAGGGACCTTAGTGACAAGG - Intergenic
1037349740 8:17939091-17939113 ACACAGGAATTTTAGTTGGGTGG + Intronic
1037701126 8:21274691-21274713 ACACAGGGAGTGGAGGGGGAAGG - Intergenic
1041350681 8:56945288-56945310 ACACAGGCACAGTAGTCGGATGG - Intergenic
1042020383 8:64368108-64368130 ACCCACTGACTTTAGTGGTATGG + Intergenic
1044520229 8:93190557-93190579 AAACAGGGAATCTAGTGGCAGGG + Intergenic
1045481753 8:102598250-102598272 ACACAGTGACTGTATGGGGAAGG - Intergenic
1045522815 8:102917853-102917875 ACACAGGGAAGCTGGTGGGAGGG + Intronic
1046436229 8:114192934-114192956 ACACCGGGCCTGTCGTGGGATGG + Intergenic
1046629619 8:116610453-116610475 ACACAGGGACTTAGGTGGGCAGG + Intergenic
1049038654 8:140096247-140096269 AGACAGGGAGGTAAGTGGGAGGG + Intronic
1050240428 9:3628872-3628894 AGACAGGGACAGTAGTGGGTGGG - Intergenic
1051225285 9:14892519-14892541 TGAGAGGGACTTTACTGGGAGGG - Intronic
1052309899 9:27054613-27054635 ACAAAGTAACTTTAGTGAGAGGG - Intronic
1060149035 9:121275617-121275639 AAACAGGTACTGTGGTGGGAGGG - Intronic
1060152665 9:121298863-121298885 ACCCAATGACTCTAGTGGGAGGG + Intronic
1203360548 Un_KI270442v1:217079-217101 ACACAGGGCCTGTGGGGGGAGGG + Intergenic
1187554833 X:20341733-20341755 ACACAGAGACTTTAGCTGGTCGG + Intergenic
1190920982 X:54852216-54852238 CGACAGGGATTTTACTGGGAGGG + Intergenic
1194370597 X:93066156-93066178 ACACCGGGACTGTTGTGGGGTGG + Intergenic
1195044495 X:101043867-101043889 AAACATGGACTTTATTGTGAAGG + Intronic
1196166399 X:112539737-112539759 TCACAGGGACTTGGATGGGAAGG + Intergenic
1197796629 X:130305347-130305369 CCACAGGGACTTGGGTGTGAAGG - Intergenic
1199095866 X:143737876-143737898 ACACAGGGTCTTTCGTAGGGTGG + Intergenic
1201339406 Y:12917256-12917278 ACATTGGGACATTAATGGGATGG + Intronic
1202112532 Y:21438338-21438360 ACACTGGGCCTTTAGTGGGCTGG - Intergenic
1202381676 Y:24279749-24279771 CAACAAGGGCTTTAGTGGGAAGG - Intergenic
1202489109 Y:25390377-25390399 CAACAAGGGCTTTAGTGGGAAGG + Intergenic