ID: 1131302713

View in Genome Browser
Species Human (GRCh38)
Location 15:91213593-91213615
Sequence AAATTTTTACAGATGAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 748}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131302713_1131302714 -8 Left 1131302713 15:91213593-91213615 CCATAATTCATCTGTAAAAATTT 0: 1
1: 0
2: 4
3: 64
4: 748
Right 1131302714 15:91213608-91213630 AAAAATTTTTACCATGTCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131302713 Original CRISPR AAATTTTTACAGATGAATTA TGG (reversed) Intronic
901254902 1:7815108-7815130 GTATTTTTAGAGATGAAGTATGG - Intronic
901353467 1:8620464-8620486 TAATTTTTACAGATATATTAGGG + Intronic
901539281 1:9904863-9904885 AAATGTTTGCTGATGACTTAGGG + Intronic
905808631 1:40895449-40895471 AAATATTTGCAAATGATTTATGG - Intergenic
906736358 1:48132858-48132880 AAATTTTAAAAAATGATTTAAGG - Intergenic
907092236 1:51736086-51736108 AAAATTTTGTAAATGAATTAAGG - Intronic
907364837 1:53949555-53949577 TAATTTTGACTGAGGAATTACGG - Intronic
907626929 1:56039713-56039735 AAATTCTAACATATGAATTCTGG + Intergenic
907770373 1:57455925-57455947 AAATTTTTAATGATGAATTCAGG - Intronic
907938175 1:59061360-59061382 AAGTTTTAACATATGAATTTTGG - Intergenic
908024135 1:59930597-59930619 AATTTTTTACTGTTTAATTATGG + Intergenic
908578018 1:65482388-65482410 AAATTTATATAGATGACTTGAGG + Intronic
908581596 1:65523126-65523148 AAATCTATACAGATGCATTTAGG + Intronic
908623762 1:66016446-66016468 AAAGTTTGACAGCTGAATAATGG - Intronic
908725650 1:67173814-67173836 AAATTATTAAAGAGGGATTATGG - Intronic
909193389 1:72584463-72584485 AAATTTCTAGATATGAAATAAGG - Intergenic
909233549 1:73121827-73121849 AAATTTCAACATATGAATTTTGG + Intergenic
909501873 1:76343865-76343887 AAGTTTTAACAGAGGAATTATGG + Intronic
909535746 1:76734142-76734164 GAATTTCAACATATGAATTATGG + Intergenic
909543866 1:76821978-76822000 ATATTTTAACAGATCAATTATGG + Intergenic
909731807 1:78901020-78901042 AGAATTTTACAGAAGAAATATGG - Intronic
909872707 1:80763446-80763468 AAATCTTTACAGAAAAATGAAGG + Intergenic
909989623 1:82207276-82207298 AAATTGTTATATATCAATTATGG - Intergenic
910359305 1:86398490-86398512 CAATTTTTAAAGAAGACTTAGGG - Intergenic
911341196 1:96640609-96640631 AAGTTTTTAGAGAAGAATAATGG - Intergenic
911390892 1:97240889-97240911 ACATCTTTACACATGGATTAGGG + Intronic
911489522 1:98546037-98546059 AAGTTTTCAAAGATGATTTAAGG - Intergenic
911695559 1:100887262-100887284 GATTTCATACAGATGAATTATGG + Intronic
912106465 1:106283026-106283048 ATATTTTTCCAAAAGAATTAGGG + Intergenic
912173385 1:107128072-107128094 AAATTTTTTCAGTGGATTTATGG - Intergenic
913435572 1:118844038-118844060 TAATTTTTACAAATGAATTGAGG + Intergenic
915893547 1:159793411-159793433 AAAATTTTAGAAAAGAATTAGGG + Intergenic
916445974 1:164872122-164872144 AAGATTTTACAGATGATTTGTGG + Intronic
916770138 1:167899752-167899774 AAAACTTTACATAGGAATTATGG + Intronic
917021211 1:170590330-170590352 ATATTTTTAGAAATGAAATAGGG - Intergenic
917108613 1:171521145-171521167 AAATTCTTACATTTGAAGTAAGG - Intronic
917615572 1:176740406-176740428 AAATATTTACATAAAAATTATGG - Intronic
917906844 1:179593066-179593088 ACATTTTTACATATGATTTCAGG + Intronic
918516924 1:185373743-185373765 AAATTTTTAAAAAAGAAATAAGG + Intergenic
918630524 1:186712145-186712167 AAGTTTTAACATATGAATTTTGG + Intergenic
918796524 1:188904929-188904951 AAATTTTTATATATGAAATGTGG - Intergenic
918882515 1:190143596-190143618 ATATTTTTATAGATGAGTAAGGG + Intronic
918922309 1:190729932-190729954 AGAATTATACAGAAGAATTATGG - Intergenic
919145446 1:193628764-193628786 AAATTCTTAAAGATAATTTATGG - Intergenic
919146183 1:193638439-193638461 AAATTTCAACACATGAATTTTGG + Intergenic
919271295 1:195350441-195350463 AAATCTTTAAAGATGTGTTAAGG - Intergenic
919341826 1:196318946-196318968 AAATTCTTATACATGTATTATGG - Intronic
921743228 1:218709767-218709789 AAAATTTTACAGATAATATATGG - Intergenic
921934563 1:220785243-220785265 AAATTTTCAAAGAGGAATTCAGG + Intergenic
921979363 1:221238891-221238913 AAATTTTTGTAGATAATTTAGGG + Intergenic
922199728 1:223391880-223391902 GAATTTTAACATATGAATTTGGG + Intergenic
922311063 1:224391395-224391417 AAATTTTAACAGTAGAATTAAGG - Intronic
922311064 1:224391433-224391455 AAATTTTAACAGTAGAATTATGG - Intronic
923068070 1:230538395-230538417 AAATTTTAACATATGGATTTGGG + Intergenic
923648852 1:235852799-235852821 AAAATTTTACAGATAAACTAAGG + Intronic
923889100 1:238191528-238191550 AAGTTTTAACATATGAATTTTGG - Intergenic
923907558 1:238402267-238402289 ATATTTTTACAAATGAAGAAAGG + Intergenic
1063238383 10:4142624-4142646 AAATTTTTTAAAAGGAATTAAGG - Intergenic
1063396742 10:5694920-5694942 AAATAATAACAGATCAATTAGGG - Intronic
1063748508 10:8914807-8914829 AAAGTTTTACCCATGAATTTTGG + Intergenic
1063762212 10:9092808-9092830 AAATGATTACAGATGAATTTAGG - Intergenic
1065333422 10:24628439-24628461 ACATGTTTACAGATTATTTATGG + Intronic
1065401828 10:25312541-25312563 AAAAATTGACAGATAAATTATGG - Intronic
1065738695 10:28777019-28777041 AAATTTTCACAGATGACATCTGG + Intergenic
1065964155 10:30757270-30757292 AAATTTTTGTAGATAAATGATGG - Intergenic
1067516182 10:46946977-46946999 AAATTTTTAAAAAGGAAATAAGG - Intronic
1067646065 10:48104830-48104852 AAATTTTTAAAAAGGAAATAAGG + Intergenic
1067679471 10:48420744-48420766 AAATTTTAAGAGATACATTAAGG + Intronic
1067968165 10:50938050-50938072 AAATGTTTACATATGCATCAAGG - Intergenic
1067968275 10:50939907-50939929 AAATTTCAACATATGAATTTGGG - Intergenic
1068158990 10:53239286-53239308 AAATTTTTAAAGGAGTATTAAGG + Intergenic
1068265397 10:54642038-54642060 ATATTTTAACATATGAATTATGG - Intronic
1068333395 10:55601682-55601704 AAATTATTAAGGTTGAATTAAGG + Intronic
1068513306 10:57993798-57993820 CATTTTTTTCAGATGAAATAAGG - Intergenic
1069183557 10:65393539-65393561 ATATTTTAACATATGAATTTTGG + Intergenic
1069258561 10:66364791-66364813 AAATCATTACAGAGGAAATATGG - Intronic
1069316694 10:67113331-67113353 AAATTTTAAAAGATGAGTCAGGG - Intronic
1070500297 10:77066371-77066393 AAATTTTTAAAAATGAGTCAAGG + Intronic
1071096249 10:81978883-81978905 AAATTTTTAAAAATACATTATGG - Intronic
1071195781 10:83157566-83157588 AAATTTTAACCTCTGAATTATGG + Intergenic
1071904924 10:90162252-90162274 TAATTTTTTCAGATGAGTTGGGG - Intergenic
1071982845 10:91021256-91021278 AAATTTTTCCACTTGTATTAAGG - Intergenic
1072171074 10:92862339-92862361 AGGTTTTAACATATGAATTATGG - Intronic
1073001476 10:100289170-100289192 CAATTTTAACGGATGAATTTGGG - Intronic
1073640750 10:105250256-105250278 AAGTTTTGACAGATGAATGGGGG + Intronic
1073900872 10:108219343-108219365 AAATTATTACCCATGAATTTTGG + Intergenic
1074170437 10:110928944-110928966 AAGTTTTTTCATATGCATTAAGG - Intronic
1074202831 10:111254656-111254678 AAAATTCTAAAGATGAATTTTGG + Intergenic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1074637237 10:115334080-115334102 AAATTTCAACACATGATTTATGG + Intronic
1075323164 10:121508684-121508706 AATTTTGTTCAGATGAAGTACGG + Intronic
1077783319 11:5355675-5355697 TAACTTTTACAGATGATTTGTGG - Intronic
1077829098 11:5844559-5844581 AAATTTGTAAAGATAAAATAAGG + Intronic
1078504056 11:11916847-11916869 AAACTATTAAAGATGAATTGAGG + Intronic
1079188879 11:18261258-18261280 AAATTTTCACAGTTCATTTACGG + Intergenic
1079504744 11:21141049-21141071 TAGTTTTTACAGATGAAAAATGG + Intronic
1079713515 11:23716664-23716686 AGATTTTAACATATGAATTTGGG - Intergenic
1079905261 11:26237271-26237293 AAATTTTTACATCTGAAATAAGG + Intergenic
1079928183 11:26522642-26522664 TCATTTATACAGAAGAATTAAGG + Intronic
1079947583 11:26763790-26763812 AAATTTTTAGAGATCCATTAAGG - Intergenic
1080287681 11:30635225-30635247 AAACTTATCCAGATGAATTTGGG - Intergenic
1080310467 11:30884943-30884965 TGATTTTTAAAGATGAATTTTGG - Intronic
1080316138 11:30951019-30951041 AAATTTTTAAAGAAAAAATAAGG + Intronic
1080412117 11:32035455-32035477 GAATTTTATCAGATGAATTTTGG + Intronic
1080444253 11:32323172-32323194 TAATCTTCACAGATGGATTATGG + Intergenic
1081054596 11:38393462-38393484 AATTTTAAACAGTTGAATTAAGG + Intergenic
1081362100 11:42192925-42192947 AGATTTTAACACATGAATTTTGG - Intergenic
1081445553 11:43128627-43128649 AATTTTTAACACATGAATTTTGG - Intergenic
1082122876 11:48398304-48398326 AAGTTTTAACATATGAATTTTGG + Intergenic
1082556574 11:54569580-54569602 AAGTTTTAACATATGAATTTTGG + Intergenic
1082648158 11:55753715-55753737 AAATTTTTAAAAATAAATTTTGG + Intergenic
1082840451 11:57685301-57685323 AAATATTTATTGATGTATTATGG + Intronic
1083044493 11:59721621-59721643 TATTTTATACAGATGACTTATGG - Intronic
1083103195 11:60331729-60331751 GAATTTTAACATATGAATTTCGG - Intergenic
1083740057 11:64704845-64704867 AACTTTTTTCAGATGACTCAAGG - Intronic
1084053075 11:66613823-66613845 AAAATTTTAGAGATGGATTTTGG + Intergenic
1085496508 11:76974750-76974772 AAATTTTTACTGTTGTATGAAGG + Intronic
1085883807 11:80498951-80498973 AGATTTCAACAGATGAATTCTGG - Intergenic
1086274945 11:85115589-85115611 AAAATTATACAGAGGAATTGAGG + Intronic
1086579922 11:88387351-88387373 AGATATTTACATATGAATTAGGG - Intergenic
1086738408 11:90336720-90336742 AAACTTATACAGATAAACTAAGG - Intergenic
1087481127 11:98701524-98701546 TAATTTTTACATATGAATTTTGG + Intergenic
1088119510 11:106351556-106351578 ACATTTTAACATATGAATTTTGG + Intergenic
1088190296 11:107220930-107220952 AACTTTTTTCAGGTTAATTATGG + Intergenic
1088447846 11:109951469-109951491 TAATGTTTAAAGAAGAATTAAGG + Intergenic
1090949181 11:131457727-131457749 AAATTTTAACACATAAATTTGGG - Intronic
1091862047 12:3794425-3794447 AGATTATTACAGGTGAATGATGG + Intronic
1092647956 12:10600117-10600139 ACAATTTTATAGAGGAATTACGG - Intergenic
1092672924 12:10883532-10883554 ACATATTTACAGATGAAAGAGGG - Intronic
1092676804 12:10929936-10929958 ACATATTTACAGATGAAAGAGGG + Intronic
1092697353 12:11187939-11187961 AAATTGTTTTAGATGAAATAAGG + Intergenic
1092770644 12:11893359-11893381 GAATCTTAACAGTTGAATTATGG + Exonic
1093081182 12:14813087-14813109 TAATTTTTAAAGCTGAGTTATGG + Intronic
1093826754 12:23700714-23700736 AAATATGTAGAGAAGAATTAAGG + Intronic
1094088526 12:26621916-26621938 TAAATTTTACTGATGAATTTGGG - Intronic
1094718973 12:33042605-33042627 AAATTTTTCCTGAGAAATTATGG - Intergenic
1095210091 12:39483750-39483772 AAAATGTTACTGATGAATCATGG + Intergenic
1095237372 12:39813475-39813497 AAATAGTAACAGATGAAATATGG - Intronic
1095247230 12:39937082-39937104 AAATTTTTTCAGAAGAACCATGG + Intronic
1095392021 12:41718799-41718821 AAATCATTGCAGATGCATTATGG - Intergenic
1095759309 12:45810790-45810812 TAATTTTTACAAATAAATAAAGG + Intronic
1095787523 12:46126330-46126352 ACATTTTTACAGCTGTCTTATGG - Intergenic
1096289554 12:50330053-50330075 AAATTATTCCAGAGGAAATAAGG - Intronic
1096325261 12:50654754-50654776 ACATTTTTACAGAGGACTTAAGG - Intronic
1097259323 12:57707025-57707047 AAATTTAGACAAATGAATAATGG - Intronic
1097409814 12:59237946-59237968 AGATTTTAACATATGAATTGAGG - Intergenic
1097888726 12:64756344-64756366 AAAGTTTTACATGTAAATTAAGG + Intronic
1098363480 12:69678240-69678262 AATTTTTTTCAGATGATTTCAGG + Intronic
1098398166 12:70044193-70044215 AAACCCTTACAGATTAATTAAGG - Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098552814 12:71782358-71782380 AAATTTTTATAGATTAATTTGGG - Intronic
1098714951 12:73818665-73818687 AAATTTTAACATATGAATTCAGG - Intergenic
1098834879 12:75411900-75411922 AAAGTTTTACAGATAATTTCTGG + Intronic
1099577268 12:84396437-84396459 AAATTTTTACATATTGATTAAGG - Intergenic
1099932541 12:89090885-89090907 AACTTTATAGAGATGATTTAGGG + Intergenic
1100217023 12:92461621-92461643 AAATTTCAACATATGAATTTTGG + Intergenic
1100397214 12:94195603-94195625 AAATTTGTACAGATAATTGAAGG - Intronic
1100476522 12:94940432-94940454 AAATTTCAACATATGAATTCTGG - Intronic
1100598378 12:96091011-96091033 AAATTTCAACATATGAATTTTGG - Intergenic
1100844004 12:98641472-98641494 AAATGTTTACAAATGTCTTATGG + Intronic
1101026341 12:100610246-100610268 AAATTGTTAAAAATTAATTATGG + Intronic
1101196632 12:102390165-102390187 AAATTTTTACATCTGCATTGTGG + Intergenic
1101861936 12:108489761-108489783 AAATTTTGACACATAAATGAGGG - Intergenic
1102367261 12:112348897-112348919 AAATCTTAACAGAGGAATTATGG + Intronic
1102947677 12:117004266-117004288 AAATGTTTACAGATAAAAGAGGG - Intronic
1103449403 12:121017707-121017729 CAATTTTAACATATGAATTTTGG - Intergenic
1105452731 13:20514792-20514814 ACATTTTTACAGAAAAATTGTGG - Intronic
1106117704 13:26831278-26831300 AAATATTTACGGAAGATTTAGGG - Intergenic
1106285083 13:28311400-28311422 AAATGTTAACAGTTGAATTTAGG + Intronic
1106816133 13:33409262-33409284 AATTTTATACAGATGAAATGAGG - Intergenic
1107006551 13:35619081-35619103 AAATTTTTACATTTGCATTTGGG - Intronic
1107215242 13:37909973-37909995 AAGATTCTACAGATGAATTTTGG - Intergenic
1107618450 13:42198024-42198046 AAATATTAAGAGATGTATTAAGG - Intronic
1107625544 13:42278856-42278878 AAATTTATTCACATGAATAAGGG - Intronic
1108064913 13:46567312-46567334 ACAATTTTATAGATGAAATAGGG + Intronic
1108086808 13:46802166-46802188 AAATTTCCACATATGAATTTTGG - Intergenic
1108582303 13:51837899-51837921 TAACTTTTACAGATGAAATGTGG - Intergenic
1108984888 13:56574482-56574504 AGATTTTTAAAGAAAAATTATGG + Intergenic
1109013436 13:56978407-56978429 AGATTTTTACACATAAATTTTGG - Intergenic
1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG + Intergenic
1109517296 13:63460320-63460342 AAATTTATACATGTGAATTTTGG + Intergenic
1109571782 13:64202058-64202080 AAAATTTTACAGAACAAGTAAGG + Intergenic
1109613656 13:64800981-64801003 TAATCTTTAAAGATAAATTATGG - Intergenic
1109707937 13:66123564-66123586 ATATTTTTGAACATGAATTATGG + Intergenic
1109726744 13:66351177-66351199 TAATTTTTATACATAAATTATGG - Intronic
1109785502 13:67169281-67169303 AAATTTGAACAGATGATTTTAGG - Intronic
1109874273 13:68378897-68378919 AAATTTCAACACATGAATTTTGG + Intergenic
1109899185 13:68741438-68741460 ACATTTTCACTGAAGAATTAAGG + Intergenic
1110049697 13:70880321-70880343 TATTTGTTACAGATGAATGAGGG + Intergenic
1110697075 13:78503676-78503698 ATATTTTTCCAGATAAATTAAGG + Intergenic
1111453547 13:88450254-88450276 AAATGTTTACAAAGGAAATATGG - Intergenic
1111701606 13:91696338-91696360 AAATTATTACTGATAAATTATGG + Intronic
1112240490 13:97676762-97676784 AGATTTTAACATATGAATTTTGG + Intergenic
1112258351 13:97855249-97855271 AATTTTTTCCAGATTTATTAAGG - Intergenic
1112879307 13:104086316-104086338 ACAATTGTACAGTTGAATTAAGG - Intergenic
1112939858 13:104848246-104848268 AAATTTTAGCACATGAATTTGGG - Intergenic
1113264320 13:108600517-108600539 AAATTTCTAAAGATGATTGATGG - Intronic
1113636429 13:111921929-111921951 ACAGTTTTACAGAAGTATTAGGG - Intergenic
1114007163 14:18326564-18326586 AAATTTATACAGCATAATTATGG - Intergenic
1114074546 14:19149971-19149993 AAATATTTTGAGATGAATAAAGG - Intergenic
1114087721 14:19250004-19250026 AAATATTTTGAGATGAATAAAGG + Intergenic
1114242934 14:20885781-20885803 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114245326 14:20907807-20907829 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114249861 14:20949718-20949740 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114732479 14:25008171-25008193 AAATTTTTAAAAATGAATTGTGG - Intronic
1114917192 14:27283695-27283717 AAAATTTTAAAGATAATTTAAGG - Intergenic
1115083982 14:29491662-29491684 CAATTTTTACTTATAAATTAAGG + Intergenic
1115756620 14:36533299-36533321 AAATTTTTACCTCTGAATAAAGG + Intergenic
1116254425 14:42532854-42532876 ATATTTTTACAAAAGAATCAAGG + Intergenic
1116400705 14:44503902-44503924 AGATTTTTACAAAAGAAATAAGG + Intergenic
1116407945 14:44588357-44588379 AGACTTGCACAGATGAATTATGG + Intergenic
1116543201 14:46126316-46126338 AAATTTTTATAAATGGAATAAGG - Intergenic
1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG + Intergenic
1117099178 14:52328381-52328403 AAATATAGACAGATGAATTTTGG - Exonic
1117612263 14:57496655-57496677 AAAGTTTTACACTTGAATGATGG + Intergenic
1117671862 14:58116155-58116177 AAATTTTTATAGATTAATAATGG - Intronic
1117915853 14:60677141-60677163 AAAGTTTTACATATCAATTCTGG + Intergenic
1117941383 14:60969948-60969970 AAATATTTACAAATGTATAAAGG - Exonic
1118201946 14:63682754-63682776 AAACTTTTACACTTGAATTCTGG - Intergenic
1118547720 14:66911924-66911946 AAAATGTAACAGGTGAATTAGGG - Intronic
1119284261 14:73438782-73438804 TAATTTTTTAAAATGAATTAGGG + Intronic
1120036445 14:79703859-79703881 AAATTTTTACTGAAAAGTTATGG - Intronic
1120157343 14:81108172-81108194 AAAGTTTTACACATTAATTATGG - Intronic
1120345171 14:83279429-83279451 AAAGTTTTCCAGCTAAATTATGG + Intergenic
1120679032 14:87457249-87457271 AAATTTTTAAAAATGAAAGAGGG - Intergenic
1120804736 14:88735059-88735081 AAATATTTACAGATGAAATCAGG + Intronic
1120805560 14:88745587-88745609 AATTTGTTACATATGTATTATGG - Intronic
1120845444 14:89121115-89121137 AGATTTTGACATATGAATTCTGG + Intergenic
1121060379 14:90902494-90902516 AAATTTTTAAATATGAATAGAGG + Intronic
1121060609 14:90905692-90905714 AAATTTTTAAAGATTACTTCTGG + Intronic
1121366197 14:93313018-93313040 AAATTATTACAAACAAATTAGGG - Intronic
1121886566 14:97548378-97548400 AAATTTCAACATATGAATTTTGG + Intergenic
1123156932 14:106235805-106235827 AAATATTTACAGATGAAATAGGG - Intergenic
1123463560 15:20496222-20496244 AAATATTTGCAGATGAGTAAAGG + Intergenic
1123654502 15:22504203-22504225 AAATATTTGCAGATGAGTAAAGG - Intergenic
1123791685 15:23727490-23727512 GAATTTTGACATATGAATCAAGG - Intergenic
1124274404 15:28313620-28313642 AAATATTTGCAGATGAGTAAAGG + Intronic
1124308412 15:28599399-28599421 AAATATTTGCAGATGAGTAAAGG - Intergenic
1124613933 15:31228304-31228326 AAATTTCTACATATGAATTTGGG - Intergenic
1124623038 15:31289370-31289392 AAATTTTTAAAAATTAGTTAAGG + Intergenic
1124830329 15:33142564-33142586 AGATCTTTACAGATGGGTTATGG - Intronic
1125143814 15:36442074-36442096 AACATTTTACAGATTATTTAAGG + Intergenic
1125455010 15:39848574-39848596 CAATTTTTAAAAATGTATTAGGG - Intronic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1125655298 15:41351821-41351843 ATTTTTTTTCAGATGTATTAAGG - Intronic
1126233179 15:46351628-46351650 AAATTTTAACAAAAGAATAATGG - Intergenic
1126314840 15:47358846-47358868 CAATTTTTAAACATGAATTCTGG + Intronic
1126384207 15:48077069-48077091 AACTTGTTAGAGGTGAATTAAGG + Intergenic
1126537922 15:49787286-49787308 AAATTTTAACAGATTAAATCTGG - Intergenic
1126954374 15:53915857-53915879 AAATCTATGCATATGAATTAAGG + Intergenic
1127384478 15:58456276-58456298 AAAATTTTACATTTGCATTAAGG + Intronic
1127565368 15:60183060-60183082 AAATTTCTTCATTTGAATTATGG + Intergenic
1129580491 15:76803803-76803825 AAATTTCAACATATGAATTTTGG + Intronic
1129664181 15:77570173-77570195 AAATATTTACACATGTATTCAGG + Intergenic
1130063584 15:80587032-80587054 ACATTTTTACCAGTGAATTATGG + Intronic
1130114872 15:80998015-80998037 AAGTTTTAACATATGAATTTGGG + Intergenic
1130164911 15:81444707-81444729 AAATTAGTTTAGATGAATTATGG + Intergenic
1130439351 15:83935759-83935781 AACATTTTAGAGATGAAATAGGG + Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1131376660 15:91930081-91930103 AAAATTAAAGAGATGAATTATGG - Intronic
1132472673 16:114733-114755 AAATTTTTTCAGATGTACAAAGG + Intronic
1134559283 16:15194041-15194063 GGATTTTAACAGATGAATTTTGG - Intergenic
1134919820 16:18105654-18105676 GGATTTTAACAGATGAATTTTGG - Intergenic
1135496250 16:22954025-22954047 TTATTTTTACATATGAGTTAAGG - Intergenic
1135568139 16:23527905-23527927 AAATTTCAACATATGAATTTAGG - Intronic
1136093997 16:27940978-27941000 TAATTTTTATAGATGGTTTAAGG - Intronic
1137699343 16:50485242-50485264 AGATTTTAACATATGAATTTTGG - Intergenic
1137797531 16:51234646-51234668 TACTTTTTACAGTTGAGTTAAGG + Intergenic
1137941342 16:52689913-52689935 AAATATTTACAGTTGAAGGATGG - Intergenic
1138007521 16:53351727-53351749 AAGTTTTAACACATGAATTTTGG + Intergenic
1138228134 16:55316483-55316505 AAATTTATACATATAAATAAAGG - Intergenic
1138766510 16:59611940-59611962 AAATTTATACTGATGACTTCTGG + Intergenic
1138907106 16:61350197-61350219 ATATTTTTATATATTAATTATGG + Intergenic
1138984006 16:62304704-62304726 AAATTATGAAAGATGAATGATGG - Intergenic
1139007381 16:62589545-62589567 AAATTTTAATACATGATTTATGG + Intergenic
1139849625 16:69942893-69942915 AAATTTTTAAAGAAAAATAAAGG - Intergenic
1140355545 16:74302782-74302804 AAAGTTTAAGGGATGAATTACGG + Intronic
1140433177 16:74922218-74922240 AAATTTCTCCAGATGAGTTGGGG - Intronic
1140554020 16:75899998-75900020 AAATATATACAGAAGTATTAAGG - Intergenic
1140610562 16:76593489-76593511 AAATGTTTACTCTTGAATTATGG - Intronic
1140717110 16:77736579-77736601 ATATTTTTAAAAATGAATTTTGG + Intronic
1140972222 16:80024408-80024430 AACATTTTACAGATGGATAAAGG + Intergenic
1142693545 17:1621166-1621188 AGATCTTTACAGAGGAATCAGGG + Intronic
1143740797 17:8952626-8952648 ATATTTTTATAAATGAATTAGGG + Intronic
1144056969 17:11551855-11551877 AAATTTTTAAAGAAGAGTTCAGG - Intronic
1144660853 17:17069418-17069440 AAATATTTACGGATAACTTAGGG + Intronic
1147710878 17:42463501-42463523 CAATTTTTAAAAATGAACTACGG - Intronic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1149053726 17:52337449-52337471 AAACTTTCATAGATGAATGATGG - Intergenic
1149808824 17:59646399-59646421 AAATTTTTGCACATGTGTTACGG + Intronic
1150868130 17:68876380-68876402 CAATTTTTACAGAAGAAAAATGG + Intronic
1150907330 17:69351842-69351864 AGATTTTAACATATGAATTTTGG - Intergenic
1151184786 17:72355777-72355799 GAATTTCAACATATGAATTATGG + Intergenic
1153037458 18:777459-777481 AAAATTTTTCATATGACTTATGG - Intronic
1153202498 18:2660384-2660406 TAATTTTTATAGATGAAGCAGGG + Intronic
1153754663 18:8268493-8268515 AAACATTTAAAGAAGAATTAAGG + Intronic
1154459959 18:14572998-14573020 ATATTTTTAGAGATGAAAAAGGG - Intergenic
1154960994 18:21308568-21308590 AATATTCTAAAGATGAATTAGGG - Intronic
1155126264 18:22879279-22879301 AAATTGTTAAAGCTGAACTATGG + Intronic
1155134376 18:22973630-22973652 CATTTTTTATAGATGAATGATGG - Intronic
1155310231 18:24516190-24516212 ACATTTTTACAGTTTAATTCTGG - Intergenic
1155406072 18:25488389-25488411 TAATTCTTTCAGATGAACTATGG + Intergenic
1155782952 18:29861878-29861900 AATCTTTTTCACATGAATTATGG - Intergenic
1155875675 18:31084286-31084308 AAAATTTTTCAGTTGAAATAAGG - Intronic
1156368318 18:36449746-36449768 AAATTTTTCTCGATGTATTAGGG + Intronic
1156636581 18:39037994-39038016 TAATTTTTAAAGAGGACTTAAGG - Intergenic
1157021618 18:43789587-43789609 AAATTATTACAACTGCATTAAGG - Intergenic
1157670341 18:49523237-49523259 AAATATTTATGGATGAATGAAGG - Intergenic
1157832447 18:50869115-50869137 AAATTTATAAAAATGAATCATGG + Intergenic
1158237901 18:55339885-55339907 ATATTTGTACAGATGTTTTAAGG - Intronic
1158391295 18:57047364-57047386 AAATTACTACAGAGGAATAAGGG + Intergenic
1158744050 18:60177194-60177216 TAATTTTTAAAGATGAGTAATGG - Intergenic
1158880496 18:61774769-61774791 CAATTTCTAGAAATGAATTATGG + Intergenic
1159061718 18:63520965-63520987 AAATTTTTAAAGGTAAAATAAGG + Intergenic
1159294642 18:66468516-66468538 AAGTTTTTAAAAAGGAATTAAGG + Intergenic
1159303130 18:66603815-66603837 AAATATTTACATAGGAAATAAGG - Intronic
1159458345 18:68692435-68692457 GAATAGTTACAGATGAATGAAGG - Intronic
1159547800 18:69862226-69862248 ACATTTTTACAGTTGTAGTATGG - Exonic
1159733770 18:72066752-72066774 AAATTTTGAAAGATGGATTTTGG + Intergenic
1161745093 19:6053152-6053174 AAATTTTTTCAGAAGAAGAAAGG + Intronic
1161771814 19:6235057-6235079 AAATATTTACACATGAAATGAGG + Intronic
1163868407 19:19795828-19795850 AATTTTTTACAAATGTATTTTGG - Intronic
1163911359 19:20196774-20196796 AATTTTTTACAAATGTATTTTGG + Intronic
1163922346 19:20302715-20302737 AATTTTTTACAAATGTATTTTGG + Intergenic
1163946917 19:20546144-20546166 AATTTTTTACAAATGTATTTTGG - Intronic
1163971848 19:20805637-20805659 AATTTTTTACAAATGTATTTTGG + Intronic
1164020118 19:21294896-21294918 AATTTTTTACAAATGTATTTTGG - Intronic
1164287422 19:23831402-23831424 AATTTTTTACAGATGTATTTGGG + Intergenic
1164438758 19:28255182-28255204 ACATTTTTACAAATGCATAAAGG - Intergenic
1165203946 19:34168060-34168082 AAATTGTTACAGATGGAAAAAGG - Intergenic
1165293600 19:34908186-34908208 ACATATTTACATATGAATTTGGG - Intergenic
1168131051 19:54318883-54318905 AATTTTTTACTGATAAATTCAGG - Intergenic
1168662862 19:58181820-58181842 AATTTTTTAAAGTTGAAATATGG + Intergenic
925469325 2:4142092-4142114 AAATTATTACATTTTAATTATGG - Intergenic
925519315 2:4723944-4723966 AAATTTTTACAGGTTAGTTGCGG - Intergenic
925799391 2:7583140-7583162 GACTTTTTACATATGAATTCTGG + Intergenic
926897716 2:17712742-17712764 AAATTTTTCGGTATGAATTATGG - Intronic
926899331 2:17732854-17732876 AAAGTTTTAAAGATGTTTTAGGG + Intronic
927449571 2:23195874-23195896 AAAATTTTAAAAATGTATTATGG + Intergenic
928065301 2:28158786-28158808 GAATTTTTACACAGGAATTGTGG + Intronic
929414442 2:41732969-41732991 ATATTTTTAAAAATGAATTTGGG + Intergenic
929426190 2:41846975-41846997 AAATGTTCACAGCTGAATTCTGG + Intergenic
930205425 2:48582915-48582937 AGATCTTTAGAGATTAATTAGGG - Intronic
931076910 2:58725530-58725552 AGATTTTGACATATGAATTTGGG - Intergenic
931110268 2:59103004-59103026 AAATTTCAACATATGAATTTTGG - Intergenic
931225775 2:60328857-60328879 AAAATTTTATACATGAATTTAGG + Intergenic
931586003 2:63828833-63828855 TAATTTTTAAAGATTATTTAAGG - Intergenic
932368486 2:71168353-71168375 AAGTTTTAACACATGAATTTTGG - Intergenic
932958196 2:76380899-76380921 AAATTTTAACACGTGAATTTTGG + Intergenic
932981024 2:76667138-76667160 AAATTTCTACAGATAAATGTTGG - Intergenic
933003855 2:76964367-76964389 ATAATTTTACAGATAAATTCAGG + Intronic
933016398 2:77132783-77132805 AAGTTTTAACACATGAATTATGG + Intronic
933143831 2:78826484-78826506 AAATTTTGTCAAATGAACTATGG + Intergenic
933380132 2:81532252-81532274 AAATTTTTACGGCTGTATTTTGG + Intergenic
933478468 2:82822353-82822375 AAATAATGACAGATGAAGTAGGG + Intergenic
935367680 2:102311675-102311697 AAATTTTCACATACGAATTTAGG + Intronic
935701851 2:105819766-105819788 AAATTTTAATAGGTGAATCAAGG - Intronic
936454164 2:112658586-112658608 AAATATTTACAGAAAAATTTTGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937116865 2:119412698-119412720 AAATATTTACATGTGAATAATGG - Intergenic
937548662 2:123058208-123058230 AAATTTTGAAAGATGGATAATGG - Intergenic
939358012 2:141129087-141129109 AAATTTTAAAAAATGAAATAAGG + Intronic
939944857 2:148397134-148397156 AAATTCATAGAGATGTATTAAGG - Intronic
940163871 2:150746122-150746144 AAATTTTAATAGATGTATAATGG - Intergenic
940461745 2:153972593-153972615 AAAATGCTACAGATGAATTGGGG + Intronic
940478742 2:154200778-154200800 AAATTTTAACACCTGAATTTTGG + Intronic
940547447 2:155106471-155106493 AAACTTTTAAAGAAGAACTAAGG + Intergenic
940585995 2:155650595-155650617 TAATTTTCAGAGATAAATTATGG - Intergenic
941539563 2:166765676-166765698 AAATTTTAACAGACAAATTAAGG - Intergenic
941628739 2:167860520-167860542 AAATATTTACAGATCACATATGG - Intergenic
941652673 2:168109743-168109765 TAATTTTTGCTGATCAATTAGGG + Intronic
941681312 2:168402324-168402346 AACTTGATACTGATGAATTATGG + Intergenic
941687920 2:168466629-168466651 ACATTCTTACAGATGAATTACGG - Intronic
941724697 2:168848842-168848864 AAAGTTTTAGAGATGAATTATGG + Intronic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
942826483 2:180183333-180183355 AAATTTTTATAGATTAATATTGG - Intergenic
942863616 2:180645989-180646011 AATTTTTTTCAGCTGTATTAAGG + Intergenic
943126379 2:183797650-183797672 GAATTTTAACATATGAATTTTGG - Intergenic
943345268 2:186731504-186731526 AAATTTTGACTGAAGGATTAGGG + Intronic
943671205 2:190663155-190663177 TGATTTTTAAAAATGAATTATGG + Intronic
943907627 2:193519551-193519573 AACTTTTTAAAGATTAGTTATGG - Intergenic
944216119 2:197257820-197257842 AAATTTCTGGAGATGAATGATGG - Intronic
944497498 2:200323450-200323472 AAATATTTTCAAATGAAGTATGG + Intronic
944645427 2:201775489-201775511 CAATGTTTACACATGGATTATGG + Intronic
945078272 2:206062611-206062633 ATACTTTTAAAGATGAAATATGG - Intronic
945411502 2:209514512-209514534 TCTTTTTTACAGATGAATTTAGG - Intronic
945488176 2:210423151-210423173 AAATTTTTATATATGAATAATGG + Intergenic
945589262 2:211709438-211709460 AAATTCTTACAGATAAAACATGG - Intronic
945636384 2:212357451-212357473 AAATTATTATAGGTAAATTATGG + Intronic
945843785 2:214918800-214918822 AAATTTCAACACATGAATTTTGG - Intergenic
945890372 2:215424592-215424614 ATATTTATACAGGTCAATTAAGG + Intronic
946708633 2:222484476-222484498 AAACTTTTAAAGATGAAATTCGG + Intronic
946888668 2:224251398-224251420 AAATTGTTAGAGATGTATTATGG + Intergenic
947050919 2:226042355-226042377 AATTTTTCATAGATGAGTTAAGG - Intergenic
947121735 2:226822715-226822737 AAATTTCAACATATGAATTTTGG - Intergenic
947220852 2:227791148-227791170 TAGTTTTTACATATGAAATATGG - Intergenic
947674728 2:231967815-231967837 AATTTTTAATAAATGAATTAGGG + Intronic
947903404 2:233741768-233741790 AATTTTTTACAGAAAAATCATGG - Intronic
947904834 2:233753449-233753471 AATTTTTTACAGAAAAATCATGG - Intronic
1168906016 20:1404453-1404475 AAATTTCAACATATGAATTTGGG + Intergenic
1170060988 20:12258920-12258942 AAATTCTTACTGTTGAATTGAGG - Intergenic
1170231627 20:14053669-14053691 TAATTTTTCAAGATGAAGTATGG + Intronic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1170485282 20:16809529-16809551 AAATTTATACTGGTGAAGTAAGG + Intergenic
1170777759 20:19392414-19392436 AAAGTTTTAGAGAAGACTTATGG + Intronic
1173891168 20:46511822-46511844 AAATTTTTAGATATAAATGATGG + Intronic
1174530452 20:51208654-51208676 AAATGTTAACAGATGCATGAAGG + Intergenic
1175016765 20:55799964-55799986 AAATCTTTAAATTTGAATTATGG - Intergenic
1175068119 20:56307773-56307795 AGATTTTGACACAGGAATTAGGG - Intergenic
1176704468 21:10101740-10101762 AGAACTTGACAGATGAATTAGGG - Intergenic
1176814156 21:13579828-13579850 ATATTTTTAGAGATGAAAAAGGG + Intergenic
1177035518 21:16038017-16038039 AAATTTTGAAAGCTGACTTATGG - Intergenic
1177043554 21:16142702-16142724 TAATTTTTGCATATGATTTAAGG + Intergenic
1177529791 21:22344273-22344295 AAATTTTTCTAGGTGGATTATGG - Intergenic
1177579308 21:22998924-22998946 AAAATTTTACAAATGCATGAAGG + Intergenic
1177678824 21:24337653-24337675 ATATTTTAGCAGATGAATTTTGG + Intergenic
1177706118 21:24707454-24707476 AGATTTTTGTAGATGAACTAAGG - Intergenic
1178003452 21:28190534-28190556 ATATTTTTAAAGAAGAGTTATGG - Intergenic
1178015433 21:28340248-28340270 AAATTTTTAAAGTTGAAATAAGG + Intergenic
1178221233 21:30662361-30662383 AAATTTTAATATATGAATTTTGG - Intergenic
1178298467 21:31430425-31430447 GAATATTTACAAATGATTTAAGG + Intronic
1178932127 21:36828287-36828309 AAATTTTTTTAAATAAATTATGG - Intronic
1179374709 21:40840280-40840302 GACTTTTTAAAGATGAATTAAGG + Intronic
1180431671 22:15257371-15257393 AAATTTATACAGCATAATTATGG - Intergenic
1180788985 22:18563652-18563674 CAATTTTTACAGATAAAATTGGG + Intergenic
1181232751 22:21431668-21431690 CAATTTTTACAGATAAAATTGGG - Intronic
1181245900 22:21503188-21503210 CAATTTTTACAGATAAAATTGGG + Intergenic
1183802445 22:40178483-40178505 AAATTTTTGCAGCAGATTTAAGG - Intronic
949105302 3:196120-196142 TAATTTTTCCATATGAATTTTGG + Intergenic
950949580 3:16984233-16984255 ATATTTTTAGAGAAGAAATAAGG + Intronic
950973442 3:17213886-17213908 AAAATTTAACAGATAAATGATGG - Intronic
951061672 3:18215688-18215710 AGATTTTAACATATGAATTTGGG - Intronic
951439279 3:22704657-22704679 AAATTTTTAAATCTGAATTTTGG + Intergenic
952406773 3:33012309-33012331 GAATTTTAACAGATGAGTTTTGG - Intronic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG + Intergenic
955346628 3:58166436-58166458 AAATTTTTAAAGACGAACTTAGG + Intronic
955383428 3:58459818-58459840 TAATTTTAAAACATGAATTAAGG + Intergenic
955573826 3:60337052-60337074 AATTCATTACTGATGAATTATGG + Intronic
955859114 3:63308432-63308454 AAATTATTTCAGATGAAATGTGG - Intronic
956148467 3:66216158-66216180 AAGTTTCTACACATGAATTTTGG + Intronic
957300164 3:78381535-78381557 AAGTTTTAACACATGAATTTGGG - Intergenic
957318050 3:78593306-78593328 GAATTTTAACATATGAATTCAGG + Intergenic
957637074 3:82800226-82800248 ATATTTTTCCAGATGTATTCAGG + Intergenic
957672839 3:83327767-83327789 ATATTCTTACAGGTTAATTATGG + Intergenic
957979473 3:87490188-87490210 AAATTTTATCAGATGAAATCAGG - Intergenic
958012807 3:87902060-87902082 AAATTATTTCAGTTGAATTTAGG + Intergenic
958057898 3:88437127-88437149 AAATTTTGACAGAGCAGTTATGG - Intergenic
958182240 3:90074275-90074297 AAATTTTTAAATTTGTATTAAGG + Intergenic
958844312 3:99247255-99247277 AAATTTTTAAAGAGGAAATAAGG + Intergenic
958891309 3:99786262-99786284 ATATTTTAACATATGAATTTGGG - Intronic
958998197 3:100930435-100930457 AAATATTAACAGATGCACTAAGG - Intronic
959236596 3:103730510-103730532 GCATTTTTACATATGAATTTTGG + Intergenic
959467506 3:106706220-106706242 GAATTTTTACAAATGGAATAGGG + Intergenic
960011421 3:112838016-112838038 AAATATTTAAAGAAGAAATATGG + Intronic
960035430 3:113097787-113097809 AAATTTGTTGAGCTGAATTAGGG + Intergenic
960347725 3:116555512-116555534 AACTTTTGACACATGAATTATGG - Intronic
960408843 3:117296129-117296151 AATATTTTACAAATGAACTAAGG - Intergenic
960410902 3:117323226-117323248 TAAATTTTACAGATGATATATGG - Intergenic
960630988 3:119730065-119730087 AAAGTATGACAGATGAATTGAGG - Intronic
960695639 3:120393705-120393727 CAATTTTAACATATGAATTTTGG - Exonic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
962632454 3:137292774-137292796 AAATGTTTATAGATGACTTTAGG + Intergenic
963270844 3:143284480-143284502 AAATATTTAGAGACGAATTCTGG - Intronic
963305093 3:143642671-143642693 AAATTTTTATTGATGAATTCTGG + Intronic
963408484 3:144899980-144900002 AAATTTTTAAAAATGAATACTGG - Intergenic
963438963 3:145312296-145312318 GAATTATTACAAATGAATTTAGG + Intergenic
963835973 3:150058307-150058329 AAATTTTTTAAGATACATTAAGG - Intergenic
963842833 3:150125338-150125360 AAATTATTACAGTTGCATTAAGG + Intergenic
964033743 3:152170053-152170075 AGATTTTAACATATGAATTTTGG + Intergenic
964069369 3:152612949-152612971 AAATATTTTAAGATGTATTACGG - Intergenic
964178764 3:153857836-153857858 AAATTTTAATACATGAATTTTGG - Intergenic
964357884 3:155867013-155867035 ACATTTTGAAAGATGAAATAAGG + Intergenic
964627850 3:158776494-158776516 AAATTTGTACAGGTGGATTTGGG + Intronic
964956086 3:162357582-162357604 AAATTATTACAAAAGAATTGAGG - Intergenic
965156257 3:165060899-165060921 AACTTTTTACATATGTATCATGG - Intronic
965422840 3:168483530-168483552 AAATGTTTAAAGATGTATTTAGG + Intergenic
966285232 3:178287445-178287467 ACATTTTTACACAAGAGTTAGGG - Intergenic
966515333 3:180814583-180814605 AAATTTCTTCAAATGTATTATGG + Intronic
966526711 3:180927426-180927448 AAATCTGAACAGATGTATTATGG - Intronic
966589988 3:181671692-181671714 TAATTTCTACAGATTAATTGAGG - Intergenic
966723935 3:183091664-183091686 ATAATTTTACAGATGAAGCAAGG + Intronic
967129014 3:186453480-186453502 AAATTTCAACACATGAATTGGGG - Intergenic
967370961 3:188745621-188745643 AAAGTTTGAAAGATGTATTAGGG - Intronic
967597994 3:191350493-191350515 AAGCTTTTAAAGATGAATCATGG + Intronic
967754310 3:193151608-193151630 AAATTCTAACACATGAATTTTGG - Intergenic
969145277 4:5118131-5118153 AAACATTTAAAGAAGAATTAGGG - Intronic
969513586 4:7633592-7633614 AAAGTTTTGCACATGAATGAAGG - Intronic
970089875 4:12393459-12393481 AAATTTTCTCAGTTGAATTATGG - Intergenic
971235951 4:24842587-24842609 AAATGTTTATGAATGAATTATGG + Intronic
971270387 4:25138796-25138818 AAAATTTTCCTGATGAATTTTGG - Intronic
971658069 4:29375794-29375816 GGATTTTAACATATGAATTAGGG - Intergenic
971795236 4:31218288-31218310 AAACTTATTCAGATAAATTAAGG - Intergenic
971801333 4:31295902-31295924 AAATTTTTAAATATCAATTTTGG - Intergenic
972012003 4:34194962-34194984 AAACTTTTACATATGAAATGGGG + Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972633968 4:40866268-40866290 GAATTTTTAAAGATGACTGATGG - Intronic
972662169 4:41126950-41126972 ACATTTTAACATATGAATTTTGG + Intronic
972834582 4:42854448-42854470 AAATTTGAGCAGATGAATTAAGG + Intergenic
973074513 4:45905691-45905713 AAACATTTAAAGATGAATTAAGG + Intergenic
973129080 4:46627280-46627302 AATTTTTAACAGATGAAATGAGG - Intergenic
973290230 4:48463741-48463763 AGATTTTAACATATGAATTTTGG + Intergenic
973291324 4:48473794-48473816 AAATGGATACAGATGAATAAAGG - Intergenic
973770689 4:54203802-54203824 AAGTTTTGACATATGAATTTTGG + Intronic
973770953 4:54205967-54205989 AAGTTTTGACATATGAATTTTGG + Intronic
974441840 4:61929089-61929111 AAGTTTCAACACATGAATTATGG - Intronic
974457810 4:62150337-62150359 AGATTTTTTAAAATGAATTAAGG + Intergenic
974555901 4:63446858-63446880 AACTTTGAACAGATGATTTAGGG - Intergenic
974770887 4:66411859-66411881 AATTTTTGACAAATGAATCAAGG + Intergenic
974773325 4:66444893-66444915 AAATTTATGGAGATGAATGATGG + Intergenic
974821759 4:67075661-67075683 AAATTTCAACATATGAATTTTGG - Intergenic
974830672 4:67185279-67185301 AAATATTTTCATCTGAATTATGG + Intergenic
975268040 4:72394307-72394329 AAATTTTTACAGAAATGTTAAGG + Intronic
975526545 4:75356823-75356845 AAATTTTTTTAAATGAATAATGG + Intergenic
976125485 4:81829684-81829706 AGAATTTCACAGATGAATTTGGG + Intronic
976520995 4:86026349-86026371 CAATTGTTACAGATCAATTCAGG + Intronic
977173454 4:93790992-93791014 AAATTTGTACAGAATAATAACGG - Intergenic
977688783 4:99879322-99879344 TTATTTTTCCAGATGAACTATGG + Exonic
977781355 4:100985072-100985094 AGATTTTTACACATGAATTGTGG + Intergenic
977840656 4:101699698-101699720 AAATTTTTAAAGAAGCATTGTGG - Intronic
978204432 4:106063650-106063672 AGATTTTAACATATGAATTTGGG - Intronic
978240605 4:106511434-106511456 AGATTTTTAGAGCTGAATGATGG + Intergenic
978266041 4:106825826-106825848 TAATTTTTATAGATAATTTAAGG - Intergenic
978457630 4:108911771-108911793 AAATGTTTATTAATGAATTATGG - Intronic
978983235 4:114978030-114978052 AAATTTTGACATAGGAATAATGG - Intronic
979002182 4:115236603-115236625 ATATTTTTACATAAGAAGTATGG + Intergenic
979172435 4:117618890-117618912 AAAATTTTAGAGTAGAATTATGG + Intergenic
979288313 4:118951459-118951481 AAGTTTTGACACATGAATTTTGG + Intronic
979320379 4:119316340-119316362 AAATATTTACACATGCAATATGG - Intergenic
979538316 4:121850009-121850031 AAGTTTTTTCAGATGACTCAGGG + Intronic
979616973 4:122753903-122753925 AAATTTCAACACATGAATTTTGG + Intergenic
979983925 4:127292252-127292274 AGATTTTAACATATGAATTTTGG - Intergenic
980009032 4:127575819-127575841 AAAGTTTTAAAAATTAATTATGG - Intergenic
980353298 4:131711303-131711325 AAATTTTTAAAGATAGAGTAAGG - Intergenic
980450375 4:132961091-132961113 AAATTTTTTCATATAAATTTTGG - Intergenic
980717436 4:136645264-136645286 AAAACTTTACAGATGATGTAGGG - Intergenic
981086142 4:140686220-140686242 AAATGTTAACAGGTGAATTTGGG + Intronic
981548344 4:145917020-145917042 AACTTCTTAGAGATTAATTAAGG - Intronic
981972506 4:150681467-150681489 TAATTTTTAAAAATGCATTAGGG + Intronic
982498928 4:156130048-156130070 AAATTCTTACAAATAATTTAGGG - Intergenic
982736932 4:159016841-159016863 AAAGTGTTACAGATGCATTGTGG - Intronic
982791763 4:159600405-159600427 AAATTTTAACATATGGCTTAAGG + Intergenic
983310817 4:166058670-166058692 AAATTTTAAAAGAGGAATAAAGG - Intronic
983369158 4:166837111-166837133 AACTTTTTATAGATGTAATAAGG - Intronic
983574359 4:169244281-169244303 AAATTTTTCCATGTGAATTGAGG + Intronic
984190482 4:176600179-176600201 AAATTTTTAAAAATGAACAAAGG - Intergenic
984252956 4:177356222-177356244 ACATTTTAACTAATGAATTAGGG + Intronic
984373639 4:178899446-178899468 AAACTATTACAGATACATTAGGG + Intergenic
984660272 4:182366148-182366170 AAATATTTACAAATAGATTAAGG - Intronic
984709930 4:182876429-182876451 AAGTTTTGACATATGAATTTGGG - Intergenic
985088713 4:186342117-186342139 AAATTTCCACATATGAATTTGGG + Intergenic
985213535 4:187622466-187622488 AAGTTTTAACAGATGAATTTTGG - Intergenic
985384004 4:189425998-189426020 AAATTTTTCCCGCAGAATTAGGG + Intergenic
986112953 5:4738568-4738590 TAATTTTTGAAGATGAATTAGGG - Intergenic
986694745 5:10341629-10341651 AGATTTTAACATATGAATTTTGG + Intergenic
986776074 5:11014947-11014969 AAATTTTAAAGCATGAATTAAGG - Intronic
987098652 5:14573049-14573071 AAGTTTCAACATATGAATTACGG + Intergenic
987304787 5:16627250-16627272 GATTTTTTACTGAAGAATTAAGG - Intergenic
987461092 5:18211405-18211427 GAATTTTTTGAGATGATTTAGGG - Intergenic
987473434 5:18360755-18360777 ACATTTTTCCAGCAGAATTAAGG + Intergenic
987786695 5:22509535-22509557 AAATTTTCACAGAAAAATAAGGG + Intronic
987888483 5:23843621-23843643 AAATTTTAACAGGTTTATTAAGG - Intergenic
987931228 5:24401302-24401324 AAAATTTTAAAGATAAATGAAGG + Intergenic
988071615 5:26296654-26296676 ATATTTTTACAGCTGCCTTATGG - Intergenic
988113960 5:26858886-26858908 TAAATTTTACAGATGAAATAAGG - Intergenic
988215388 5:28265657-28265679 AAATTTTTGCATATAAAATAGGG - Intergenic
989291909 5:39777435-39777457 AAATTTCAACATATGAATTTTGG - Intergenic
989354525 5:40528524-40528546 AAGTTTTTGCATATTAATTAGGG + Intergenic
989701968 5:44278836-44278858 AGATTTATACAGTTGAAATAAGG - Intergenic
989805882 5:45603454-45603476 TAATTTTTACAGATGAATATTGG + Intronic
989950496 5:50292505-50292527 AAATTTTAATAGATGAATATAGG - Intergenic
990161565 5:52946007-52946029 AAATTTTAACACATAAATTTAGG - Intronic
990326199 5:54678009-54678031 ATAATTTTACTCATGAATTAAGG + Intergenic
990525320 5:56620119-56620141 AAACTTTTACAGGTGAACCAGGG - Intergenic
991229546 5:64315872-64315894 ATATTTTTCCAGATTGATTAAGG + Intronic
991380186 5:66013627-66013649 AAATTTTGGCAGGTAAATTATGG + Exonic
992229883 5:74653806-74653828 AAATTTTTTCTGTTGAATTTTGG - Intronic
992268203 5:75038787-75038809 AAATTTCAACACATGAATTTTGG + Intergenic
992307897 5:75462601-75462623 AAAAGTTTAAAGAAGAATTAAGG + Intronic
992507140 5:77398194-77398216 ATATGTTTACATATGTATTAAGG - Intronic
992813462 5:80412671-80412693 AATTTTTTAGAAATAAATTATGG - Intronic
993017126 5:82546834-82546856 AAATTTTAGCAGATGATTTTTGG - Intergenic
993017267 5:82548800-82548822 AAATTTCTCCAAATGAATTTTGG + Intergenic
993110207 5:83647603-83647625 CAATTCTTACAGCTGAATTCTGG + Intronic
993661454 5:90641693-90641715 ATATTTCTACATATGAATTGTGG + Intronic
993704964 5:91159486-91159508 AAATTTTTAAAAATGTAATATGG - Intronic
993743786 5:91570676-91570698 AAATTTTTAAAAAGGAGTTAAGG + Intergenic
993798182 5:92296860-92296882 AAATATTTGAAGAAGAATTATGG - Intergenic
993941963 5:94069261-94069283 TGATTTTTATAGATGAATGATGG - Intronic
994271584 5:97783398-97783420 AAATTGAGACAGATGATTTAGGG - Intergenic
994760473 5:103845998-103846020 AGATTATGACAGCTGAATTATGG + Intergenic
994829292 5:104757834-104757856 AAATTCTTACTGATAAATTGAGG - Intergenic
994875414 5:105414648-105414670 AAATTTTTTCAGGTAAATCAGGG - Intergenic
994889696 5:105617102-105617124 AAATTATCTCATATGAATTATGG + Intergenic
994950282 5:106452912-106452934 CAAATTTTACAGATAAATTATGG + Intergenic
995021570 5:107372674-107372696 TAATTTTTACAGATTAAGTTTGG + Intergenic
995568079 5:113452333-113452355 AAGTTTTAACATATGAATTTGGG - Intronic
995700071 5:114925623-114925645 TAATTTTTACATATGATGTATGG - Intergenic
995819021 5:116206184-116206206 AAATTTGTACAAATTTATTATGG + Intronic
996426808 5:123321695-123321717 TAATTTTTATATATGATTTAAGG + Intergenic
996452676 5:123644166-123644188 AAATTTTTAAAAAATAATTATGG + Intergenic
996610686 5:125375978-125376000 AAGTTTTGACAGTTGAATTGAGG - Intergenic
996644798 5:125800428-125800450 AAATTTTTATGGATGAAATGTGG + Intergenic
997027470 5:130081925-130081947 AAGATTTAACAGAGGAATTAAGG + Intronic
998980267 5:147694749-147694771 AATTTTTCAAAGATGAATTCTGG - Intronic
999575665 5:152973737-152973759 TAAGTTTTACTGAAGAATTAGGG - Intergenic
999785495 5:154886317-154886339 AAACTTTTTAAAATGAATTATGG - Intergenic
1000221676 5:159220390-159220412 AGATTTTAACATATGAATTTTGG - Intergenic
1000820296 5:165974111-165974133 AAAATTTCACAGATGAGTTCTGG - Intergenic
1002973394 6:2048597-2048619 ATAAATCTACAGATGAATTAGGG + Intronic
1003621430 6:7704510-7704532 GGATTTCAACAGATGAATTAGGG - Intergenic
1003840029 6:10110697-10110719 AACTTTTTACAGATGAAAATTGG - Intronic
1005578161 6:27209212-27209234 AAATTTCTACAGGTGAATCACGG + Intergenic
1005656159 6:27939833-27939855 AAATTTCTGCAAATGAATAAGGG + Intergenic
1006648230 6:35530133-35530155 AAATGTTTAAAAATTAATTAAGG - Intergenic
1006764826 6:36495608-36495630 ACAGTTTTTCAGATGCATTATGG + Exonic
1008288592 6:49684686-49684708 AAATTTTAACATGTAAATTAGGG + Intergenic
1008807258 6:55445363-55445385 AAATTATTTCTGATGAAATAAGG - Intronic
1008831247 6:55765471-55765493 AAATTTTTATAAATAAATTAAGG - Intronic
1008868085 6:56239548-56239570 AAAATTTTAAATTTGAATTATGG - Intronic
1008925269 6:56885518-56885540 AAATTTCAACACATGAATTTTGG - Intronic
1009532613 6:64839940-64839962 AAGTTTTAACACATGAATTTTGG + Intronic
1009869556 6:69436281-69436303 AAGATTTTGCAGATGTATTAAGG + Intergenic
1009987207 6:70795142-70795164 GTATTTTTACAGCTGAATTCTGG + Intronic
1009988688 6:70813939-70813961 AAATGCTACCAGATGAATTAAGG - Intronic
1010115521 6:72303222-72303244 AAATTTTAAATGATGGATTAGGG + Intronic
1010661940 6:78581488-78581510 ATATTTTGACAGAGAAATTAAGG - Intergenic
1010881191 6:81174771-81174793 AAAGTATTACAAATGAATCAGGG - Intergenic
1011826830 6:91317569-91317591 CAATTTGTACAGCTGAAATAGGG - Intergenic
1011883722 6:92064317-92064339 AAAATTTTACACATTTATTATGG + Intergenic
1011989823 6:93500550-93500572 AAATTTTCAGAGATGAGCTAAGG + Intergenic
1012822808 6:104108877-104108899 TAATTTTTAAATATGAATTCTGG + Intergenic
1013688538 6:112613242-112613264 AAAATTTTCCAGATTTATTAAGG + Intergenic
1013707785 6:112859308-112859330 AAATTTTCACCTATGAATTCAGG - Intergenic
1013870190 6:114748576-114748598 AATATTTTACATCTGAATTAAGG + Intergenic
1013947167 6:115735483-115735505 AAATTGAGACAGATGATTTAGGG + Intergenic
1013961630 6:115907845-115907867 AAACTTCTACATATGAATTTGGG + Intergenic
1014275075 6:119378999-119379021 AAATTATTACATATAGATTAGGG + Intergenic
1014383456 6:120773042-120773064 TAATTTTTACAAATGAACTGTGG - Intergenic
1014644703 6:123958631-123958653 AAATTTCAACATATGAATTTTGG + Intronic
1014767879 6:125428040-125428062 AAAATTTTGCATATAAATTAAGG + Intergenic
1015086201 6:129294608-129294630 AGATTTCTACATATGAATTTTGG + Intronic
1015551774 6:134419453-134419475 AAGTTTTTCCAGGTGAAGTATGG - Intergenic
1015776385 6:136818986-136819008 AAATTTCAACATATGAATTTGGG + Intergenic
1016025755 6:139285305-139285327 AAACTTTTACATAAGAATTGGGG - Intronic
1016424635 6:143921249-143921271 AAATAATTACAAAGGAATTAGGG - Intronic
1016673657 6:146738180-146738202 AAATCTGTAAAGATAAATTAAGG + Intronic
1016930202 6:149398612-149398634 AACTTTTTAGAGTTAAATTATGG - Intronic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1017413012 6:154189414-154189436 AAATTCTTACATATGTATTTTGG - Intronic
1017518795 6:155183164-155183186 AAATATTTTCAGATGAAAGAAGG - Intronic
1017569121 6:155723960-155723982 AAATTTTTAATCATGAATTGTGG - Intergenic
1018309924 6:162497489-162497511 CAATTTTTACAAAAGAACTATGG + Intronic
1018565858 6:165152016-165152038 AAATTTTTAAGGAAGAAATAAGG + Intergenic
1019035818 6:169057858-169057880 AATTTTTTAAGGATGCATTACGG + Intergenic
1019216291 6:170446053-170446075 AAATTTTTAAATATGAACAAGGG - Intergenic
1020279974 7:6645174-6645196 CAATTTCTTCAGATGAATAAAGG - Intronic
1020631918 7:10649988-10650010 AAATTGGTAGAGATGATTTAGGG - Intergenic
1021028549 7:15700756-15700778 AAATATTTTGATATGAATTAGGG - Intergenic
1021281350 7:18722747-18722769 ACACTTTTACAAATGAAATATGG - Intronic
1021436481 7:20623234-20623256 CAATTTTAACAAATGTATTATGG - Intronic
1021830020 7:24596895-24596917 AAATTTTTAGAGTGGAATTGTGG + Intronic
1022843050 7:34182808-34182830 AGATTTCAACATATGAATTAGGG - Intergenic
1023263765 7:38383763-38383785 TAATTGTTACAGATGATTTGTGG + Exonic
1023284912 7:38608857-38608879 ATATTCCTACAGAAGAATTAGGG + Intronic
1023424241 7:40018252-40018274 AAATTGTTAGAGAGTAATTAGGG + Intronic
1023462441 7:40413701-40413723 GAATTTTTACAAATTAATAAGGG + Intronic
1024203836 7:47134243-47134265 AATTTTGTACAGAAGAATAAAGG - Intergenic
1024423296 7:49195479-49195501 AAATTTTGATACATGAATTATGG + Intergenic
1024476476 7:49817193-49817215 AGCTTTTAACAGATGAATAATGG - Intronic
1025930745 7:65991873-65991895 AAATTGTTTCTGATGAATTTTGG - Intergenic
1026659248 7:72284800-72284822 AAAGTTATACAGATAGATTAAGG + Intronic
1027741552 7:82013800-82013822 AAATTATTAAAGATGCATGATGG + Intronic
1027907836 7:84209009-84209031 AAATATTTAAAATTGAATTAAGG - Intronic
1028296360 7:89137536-89137558 AAATTTGGAGAGATGATTTAGGG + Intronic
1028331460 7:89599940-89599962 AAGTTTTAACATATGAATTTTGG - Intergenic
1028441917 7:90873056-90873078 AAATTTTCTCACAGGAATTATGG + Intronic
1028649448 7:93134973-93134995 AAATTTGTAAAGATAAAATATGG - Exonic
1028846987 7:95492347-95492369 GAAATATTACAGATGAATTGAGG + Intronic
1028892764 7:96007144-96007166 AAATTTTAACAGAACAATAAAGG - Intronic
1028952205 7:96649117-96649139 AAAGCTTTACAAATGAATTAGGG - Intronic
1028954825 7:96676745-96676767 AAATTTATACAGAGGATCTATGG + Intronic
1029025440 7:97412447-97412469 AAAATTGTTCAGATGAGTTAGGG - Intergenic
1030412679 7:109201504-109201526 AAAATTTTACAGTTCAATTTTGG - Intergenic
1030786951 7:113674240-113674262 AAATTTTAACATATGAATTTTGG - Intergenic
1030918042 7:115341449-115341471 GAATTTCTAAAGATGAATTATGG - Intergenic
1030939188 7:115624144-115624166 AAAATTTTAAAGAAGAATCAGGG + Intergenic
1031121951 7:117731899-117731921 CAATTTTTAAACATGAATTCTGG + Intronic
1031603033 7:123736339-123736361 AGATTTAGACAGATGAATTAAGG + Intronic
1031736028 7:125362966-125362988 AAAATTTTACAGATATATCATGG - Intergenic
1032376849 7:131428373-131428395 AAATTTTTCCAGATATATTGTGG - Intronic
1032926096 7:136606768-136606790 AAATATTTATAGAAAAATTATGG + Intergenic
1033055334 7:138047294-138047316 AAGTGTTTAAAGATTAATTAAGG - Intronic
1033065813 7:138153021-138153043 AAATATTTTCAGATGAATTAAGG - Intergenic
1033350978 7:140561819-140561841 AAATTATTACAGAAAAATTTAGG - Intronic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1033670771 7:143490635-143490657 AAATTTTTAAAAATGGATTTTGG + Intergenic
1033797678 7:144867009-144867031 AAATGTTTACATATGCATTATGG - Intergenic
1033966520 7:146981261-146981283 TAAGATTTACAAATGAATTATGG + Intronic
1034104970 7:148482491-148482513 AACTTGTTAAACATGAATTAGGG + Intergenic
1035193787 7:157197474-157197496 TTATTTTTACAGATAAATTTTGG - Intronic
1035817765 8:2559813-2559835 TAATTATTACAGCTGAATAATGG - Intergenic
1035934776 8:3824990-3825012 AAATTTTTAAATATGAAATGTGG + Intronic
1036040937 8:5080577-5080599 ATATTTTTACACCTGAATTTAGG - Intergenic
1036838689 8:12097688-12097710 GAATTCTTGCAGATGAACTATGG - Intergenic
1036860477 8:12343932-12343954 GAATTCTTGCAGATGAACTATGG - Intergenic
1037791146 8:21943498-21943520 AAATTTCTTCAAATAAATTATGG - Intronic
1039155402 8:34550373-34550395 AACTTAATACAGATGAATCATGG - Intergenic
1040778496 8:51076588-51076610 AAATTTTAACATATTAATTTTGG - Intergenic
1040921588 8:52626523-52626545 AAATGTTAACAGATGAATCTGGG + Intronic
1041138491 8:54788112-54788134 ATAATTTTTCAGATGAATGAAGG + Intergenic
1041390481 8:57343317-57343339 AAATTTTTACTCAAGAAGTAGGG - Intergenic
1041448841 8:57985384-57985406 AAATTAATACATATTAATTATGG - Intergenic
1041492299 8:58447648-58447670 TTATTTTTACAGATAAATTTTGG + Exonic
1042164052 8:65928099-65928121 AAATTTTTAAAAATAAATTTAGG - Intergenic
1042498451 8:69482740-69482762 AAATTTTTAAAAATTAATTAAGG + Intronic
1042740692 8:72041956-72041978 AAAATTTTACTGACTAATTAAGG + Intronic
1043071730 8:75644293-75644315 TTATTTTTAGAGATAAATTATGG + Intergenic
1043189305 8:77197667-77197689 AAATTATTCCTGGTGAATTAAGG + Intergenic
1043312627 8:78880037-78880059 AAATGTTTGGAGTTGAATTAAGG - Intergenic
1043344449 8:79283826-79283848 CAATGTCTACAGATGAATGATGG + Intergenic
1043357997 8:79436286-79436308 AAGTTTTCAAAGATGAATCAGGG - Intergenic
1043602526 8:81958038-81958060 AGATTGTTACAGATGAAAGAAGG + Intergenic
1043720176 8:83538704-83538726 ATATATTTCCAGATGAAATATGG + Intergenic
1043877251 8:85499616-85499638 AAATTTTTACAGAATATTTGTGG + Intergenic
1044152135 8:88794175-88794197 AAATTTCAACATATGAATTTGGG - Intergenic
1044341783 8:91054457-91054479 AAATTTTAGCATATGAATTTTGG - Intergenic
1044374259 8:91450812-91450834 AAATTTCCACAGATGAAATTGGG + Intergenic
1044742601 8:95343037-95343059 AAGTTTCTACATATGAATTTTGG + Intergenic
1045360908 8:101432456-101432478 AAATTGTTACAGAAAAAGTAAGG - Intergenic
1045554317 8:103200885-103200907 AGATTTATACATATGAATTTTGG + Intronic
1045617404 8:103933800-103933822 AAGTTTTTACACATTAATAAAGG + Intronic
1045905594 8:107340917-107340939 TAATTCTAACAGAAGAATTAAGG + Intronic
1046188462 8:110756098-110756120 ACTTTTTTACAGATCAATTTTGG + Intergenic
1046206649 8:111008089-111008111 TACTTTTTACATATGAAATAAGG - Intergenic
1046259092 8:111742488-111742510 CAATTATTAAAGATGTATTAGGG - Intergenic
1046403169 8:113734593-113734615 GACTTTTAACAGATGAATAAAGG + Intergenic
1046435618 8:114184244-114184266 AATTTTTTATACATGAAATACGG - Intergenic
1046690686 8:117281237-117281259 AAATTTAAACAGATTAATTATGG - Intergenic
1046948806 8:120000773-120000795 AAGTTTTTAAAAATGAATTGAGG + Intronic
1047170952 8:122491808-122491830 AGATTTTAACACATGAATTTTGG - Intergenic
1047396834 8:124508048-124508070 AAATGTTGACATCTGAATTAGGG + Intronic
1048699058 8:137066026-137066048 AAACTCTTAGATATGAATTAAGG + Intergenic
1048838250 8:138541801-138541823 CATTATTTACAGATGAATGATGG + Intergenic
1049083760 8:140461980-140462002 AAATTTAAACATATGAATTTGGG + Intergenic
1050383065 9:5051516-5051538 GAATTTTTACAGATGCTCTAGGG + Intronic
1050678991 9:8087951-8087973 AAATTTTCATAAATGAACTAAGG + Intergenic
1051070768 9:13163729-13163751 TTATTTTAACAGATAAATTATGG - Intronic
1052439379 9:28475106-28475128 ATATTTTTACAGATAAATTCAGG - Intronic
1052471141 9:28899126-28899148 AAATTTTAAAAGATGCATTGAGG + Intergenic
1052595765 9:30556601-30556623 AAATTTTTACAGAAGTGTAAAGG + Intergenic
1052782916 9:32799151-32799173 AAATTTTTATGGATTAATAATGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054322615 9:63686136-63686158 AGAACTTGACAGATGAATTAGGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054829902 9:69612301-69612323 TAATTTTTAAAAATAAATTAGGG + Intronic
1054957386 9:70928322-70928344 CAATTTTTAGAAAGGAATTACGG - Intronic
1055005688 9:71503554-71503576 AAATTTTGACATATTAAATAGGG + Intergenic
1056736132 9:89210809-89210831 GAATTTCAACAGATGAATTTAGG + Intergenic
1057033047 9:91792984-91793006 AAATGTTTAGAGAAGAGTTAAGG + Intronic
1057064174 9:92033401-92033423 AGATGTTTACAGATGAACTCTGG - Intronic
1057549711 9:96043355-96043377 AAATTTCTAGAGATGAAAAATGG + Intergenic
1058200857 9:102038355-102038377 AAATTTTTATATATCAATTTTGG - Intergenic
1058341018 9:103896784-103896806 AAATGTTTATAGCTGCATTATGG - Intergenic
1059180539 9:112208551-112208573 AAATTTATACAGTTGAATTCTGG + Intergenic
1059726873 9:117017190-117017212 AAATTTTTAAAGAAGAATTTTGG + Intronic
1059837601 9:118173494-118173516 AAATTTTTCCAGGTGACTTTGGG + Intergenic
1059937551 9:119326326-119326348 ACATTTTTACAGTTGATTTGTGG - Intronic
1060107149 9:120879815-120879837 AATTTTTTAAATATGGATTAAGG + Intronic
1060162377 9:121376451-121376473 AAAGTTTTAAAAATGAATAAAGG + Intergenic
1061752967 9:132793337-132793359 AGATTTTAACATATGAATTTTGG + Intronic
1202789503 9_KI270719v1_random:71832-71854 AGAACTTGACAGATGAATTAGGG - Intergenic
1203625447 Un_KI270750v1:14694-14716 ACATATTAACAGATGAAATATGG - Intergenic
1185925447 X:4140792-4140814 AAATTTCTGGAGATGAATAATGG - Intergenic
1185949806 X:4420517-4420539 AAGTTTTAACAGATAAATTTTGG - Intergenic
1186080078 X:5921637-5921659 AAATTTTTACAGACAACTCAAGG - Intronic
1186140794 X:6571146-6571168 TAATGTTTTCATATGAATTAAGG + Intergenic
1186275065 X:7929442-7929464 AAATTTTAAGAGTTAAATTATGG - Intergenic
1186709407 X:12177479-12177501 TAAATTTTTCAGATGAATGAAGG + Intronic
1187104662 X:16228635-16228657 AAATGTATACAGATCAAATAAGG - Intergenic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187580317 X:20600659-20600681 AAAATGTAACAGTTGAATTATGG - Intergenic
1187672591 X:21683445-21683467 AAATATTTACAAATGAAGTGAGG + Intergenic
1187731224 X:22256951-22256973 AAATTTTTACATATCAACAAGGG + Intergenic
1188236782 X:27741278-27741300 AAATTTTAACAGAAGATTTGAGG - Intronic
1188249236 X:27871878-27871900 CAATTTTAACATATGAATTTTGG + Intergenic
1188889399 X:35591115-35591137 AAACATTTATAGATAAATTAAGG - Intergenic
1188914503 X:35892861-35892883 AACTTATTGCAGATGAGTTAAGG - Intergenic
1188959558 X:36473637-36473659 AAATCTTTACAGAAGACTTTAGG + Intergenic
1189632622 X:42971135-42971157 AAATTGTGACAGGTGAATAAAGG - Intergenic
1189892748 X:45622482-45622504 AGATTTTAACATTTGAATTAAGG + Intergenic
1191652837 X:63560501-63560523 AAATGTTTACATTCGAATTAAGG + Intergenic
1191957062 X:66654397-66654419 AAACATTTAAAGAAGAATTAAGG + Intergenic
1193128802 X:77898063-77898085 AAAGTCTTAGAGATGAATAATGG + Intergenic
1193196823 X:78642108-78642130 AAACATTTAAAGAAGAATTAAGG - Intergenic
1193934386 X:87598589-87598611 TAATTTTTACAAAATAATTAGGG + Intronic
1194083904 X:89502469-89502491 AAGTTTCAACATATGAATTATGG - Intergenic
1194096596 X:89647610-89647632 TATTTTTTACAGCTGTATTAAGG - Intergenic
1194350458 X:92820105-92820127 ATATTTTTCATGATGAATTATGG + Intergenic
1195076826 X:101335305-101335327 AAATATTTAAAGATAAAATAGGG - Intergenic
1195793171 X:108612400-108612422 AAATTTTTGTAGATTTATTAGGG - Intronic
1195946322 X:110216481-110216503 AAATTTTTAAAGAAAAATGAAGG - Intronic
1196413691 X:115447572-115447594 AAATTTATATCGATGAATAAAGG + Intergenic
1197068043 X:122257692-122257714 AAATTTTTACAGCTTTATTAAGG + Intergenic
1198434623 X:136604418-136604440 AAATTTTTCCAAAAGACTTATGG + Intergenic
1199918501 X:152371101-152371123 AGATTTTTCCAGATATATTAAGG - Intronic
1199924002 X:152443304-152443326 AAATTTTTACCGATCTGTTAGGG - Intronic
1200436551 Y:3158349-3158371 AAGTTTCAACATATGAATTATGG - Intergenic
1200658774 Y:5936746-5936768 ATATTTTTCATGATGAATTATGG + Intergenic
1201066179 Y:10096970-10096992 AAATTTTAACAGATGTACAAAGG - Intergenic
1201641802 Y:16187185-16187207 AAATATTTAAAGGTGCATTATGG + Intergenic
1201661013 Y:16398136-16398158 AAATATTTAAAGGTGCATTATGG - Intergenic
1202305545 Y:23466384-23466406 TAATTTTTACAGATATATTAGGG - Intergenic
1202565264 Y:26204205-26204227 TAATTTTTACAGATATATTAGGG + Intergenic