ID: 1131302929

View in Genome Browser
Species Human (GRCh38)
Location 15:91215349-91215371
Sequence CTGCTAAAACAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131302929_1131302938 20 Left 1131302929 15:91215349-91215371 CCCTCCTCCTTCTGTTTTAGCAG 0: 1
1: 0
2: 0
3: 36
4: 339
Right 1131302938 15:91215392-91215414 GTCTGCATTTAGCTAACACCAGG 0: 1
1: 0
2: 1
3: 5
4: 90
1131302929_1131302936 -4 Left 1131302929 15:91215349-91215371 CCCTCCTCCTTCTGTTTTAGCAG 0: 1
1: 0
2: 0
3: 36
4: 339
Right 1131302936 15:91215368-91215390 GCAGTTTTGGAATGGGAGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131302929 Original CRISPR CTGCTAAAACAGAAGGAGGA GGG (reversed) Intronic
900641931 1:3691668-3691690 CTGCTAATTGAGAAGGTGGAAGG + Intronic
901274971 1:7984075-7984097 ATGCTGAAACTGAAGGAGCAAGG + Intronic
901460396 1:9387706-9387728 GAGCTAAAACAGAAGCAGAAGGG + Intergenic
901462764 1:9401275-9401297 ATTCTAAAACAAAAGGAGGCCGG + Intergenic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909632050 1:77777989-77778011 CTGCCAAACCAGAAGAAGGGAGG + Intergenic
912296272 1:108473938-108473960 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
912822197 1:112877002-112877024 CAGCTAGAAGAGAAGGAGGGTGG + Intergenic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
914423383 1:147550954-147550976 ATTCTAGAACATAAGGAGGAAGG + Intronic
918817339 1:189205522-189205544 CAGCTAAAAAAGAAGTTGGAGGG + Intergenic
919111811 1:193229464-193229486 CTCCTATCACAGAAGGAGCAAGG - Intronic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920991430 1:210943650-210943672 CTGCTTAAAAAGAAGGAGAGAGG - Intronic
922174194 1:223182332-223182354 CAGCTAAAACAGAAGGCTTAAGG + Intergenic
922663642 1:227451003-227451025 CTGCTAAAAGAGGAGGTGGCTGG + Intergenic
922850149 1:228726083-228726105 ATAATAAAACATAAGGAGGAAGG - Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
923125660 1:231032545-231032567 CTGCTAAAAGAGAAGTGGCAAGG - Intronic
923802050 1:237219645-237219667 CTGCTAGAAAGGAAGAAGGAGGG + Intronic
924673335 1:246150874-246150896 ATCCTAAAAGAGATGGAGGAAGG + Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064576175 10:16748392-16748414 CTCCTAAGACAGAGGAAGGAGGG - Intronic
1066600501 10:37100915-37100937 TTACTAAAACAGAATGAGCAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067349550 10:45463493-45463515 CTGCTGGAAGAGAAGGCGGATGG - Exonic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068946003 10:62729330-62729352 CTGCTAAAAAAGAAAGAAAAAGG - Intergenic
1070645416 10:78198781-78198803 ATGCTGAGACACAAGGAGGAAGG + Intergenic
1071484457 10:86089452-86089474 CAGCTAAAACAGAAGGCGTAAGG + Intronic
1071960880 10:90808277-90808299 CTGCTAAGAGTGAAGGAGAAGGG - Intronic
1072688956 10:97557666-97557688 CAGCTAGAACAGAAGAAAGAGGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074222307 10:111449995-111450017 TTGCTAAAAAAGAAGCATGAGGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074640599 10:115376153-115376175 CTTATAAAACAGGAGGAAGAAGG - Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1077876384 11:6311528-6311550 TTGCTTAAACAATAGGAGGAGGG + Intergenic
1078045252 11:7908158-7908180 CTTCTCAAACTGAAGGAGGAAGG + Intergenic
1078353648 11:10616742-10616764 CCACTAATACAGAAGGAGGAAGG - Intronic
1079698835 11:23518946-23518968 CTGCTGAGAGAGAAGGAGAAAGG + Intergenic
1080070037 11:28071707-28071729 CTGCTATAACAGAAGGTGGGAGG + Intronic
1080638359 11:34143011-34143033 CTGCTAAATCTGAAAGAGAAGGG + Intronic
1080798859 11:35590640-35590662 CTGCTATAGCATCAGGAGGAGGG - Intergenic
1080849308 11:36054644-36054666 CTGCTTAAAAAGAATGAAGATGG + Intronic
1082222807 11:49661937-49661959 TGGCTAAAGCAGAAGGCGGATGG - Intergenic
1084257481 11:67952901-67952923 CTGCTATTAAAGAACGAGGATGG + Intergenic
1084305921 11:68283227-68283249 CTGCTGAAAGAGAATGAGGTGGG - Intergenic
1084815288 11:71642348-71642370 CTGCTATTAAAGAACGAGGATGG - Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086240553 11:84685198-84685220 CTCCTAAAACTGAAGTTGGATGG - Intronic
1086525410 11:87719629-87719651 TACCTAAAACAGAGGGAGGAGGG + Intergenic
1086626241 11:88957274-88957296 TGGCTAAAGCAGAAGGCGGATGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087779642 11:102288621-102288643 CTGCTACAACAGATGGAGGTCGG - Intergenic
1088746382 11:112808185-112808207 CCACTAAAACAGGAGGAGGAAGG - Intergenic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1090972496 11:131655409-131655431 TTGCCAAAAAGGAAGGAGGAAGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092427712 12:8387690-8387712 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092428982 12:8394671-8394693 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092744903 12:11664221-11664243 CTGCTAACACAGCAGAAGCATGG - Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1096198564 12:49664851-49664873 CTGCTACAACAGGAGGGGAAAGG + Intronic
1096599278 12:52717974-52717996 CTTCTACAACAGAAGAAAGAAGG + Intergenic
1097920146 12:65063313-65063335 CACCTAAAATAGAGGGAGGATGG + Intronic
1098628853 12:72704280-72704302 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100491171 12:95079666-95079688 CTGCTATGACAGAAAGGGGATGG + Exonic
1100527472 12:95433122-95433144 CTTTTAAAACAGAAGCAGGCTGG + Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1103083164 12:118041491-118041513 TTGCTAAAAGAGCAGGAGAAAGG + Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104783846 12:131437456-131437478 CTGCTCCATCAGGAGGAGGAGGG - Intergenic
1105436702 13:20385553-20385575 CTGCTAAACCAGGAGTAGGCAGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107075354 13:36317325-36317347 CTGCTAAGAGTGAAGGAGAAGGG - Intronic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109551133 13:63902227-63902249 CTGATACAACAGTAGGAAGATGG + Intergenic
1109988065 13:70016573-70016595 GGGCTGAAACAGAAGGAGGCTGG - Intronic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111904709 13:94241641-94241663 AAGCTAAAACAGAAAAAGGAGGG + Intronic
1112127266 13:96481723-96481745 CAGCTAAAAAAGAAGGAGCAGGG + Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113202229 13:107878830-107878852 TTCCTAAAACTGAAGGAGGGGGG + Intergenic
1113271719 13:108682011-108682033 CTGCTAAATCAGAAACTGGAGGG + Intronic
1114804319 14:25816942-25816964 ATGCTACAACAGAGGGAAGAGGG + Intergenic
1115777030 14:36726921-36726943 CTTCTAAAAGAGAGGAAGGAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1119607938 14:76036827-76036849 TTTCTAAAAAAGAAGGAGGGAGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1125228300 15:37422133-37422155 TTTCTAAAACAGAAGGAAAATGG + Intergenic
1125385061 15:39128511-39128533 TTGCCACCACAGAAGGAGGAAGG - Intergenic
1126509333 15:49450257-49450279 CTGCTAAAAGATGATGAGGAGGG - Intronic
1126800384 15:52292794-52292816 CTGCTCAAATTGAAGGTGGAAGG + Intronic
1127841832 15:62838472-62838494 GTGCTAAATCAGATGGAGGCAGG + Intronic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1130238677 15:82164455-82164477 CTTCTAAAACAGGGGGAGTATGG - Intronic
1131002428 15:88949622-88949644 GTGCTAACTCAGAAGGGGGAGGG - Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1132223811 15:100125422-100125444 CTGCTAAGACGGCGGGAGGACGG - Intronic
1133370526 16:5242679-5242701 CTGCTATTAAAGAACGAGGATGG - Intergenic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1134692141 16:16197920-16197942 ATGCTAAGTCAGGAGGAGGAAGG + Intronic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137506039 16:49054741-49054763 TTGCTCTAACAGAAGCAGGATGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138804721 16:60079726-60079748 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140406073 16:74712433-74712455 TTCCTAAAACAGAGGGAGAAAGG - Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141295571 16:82765424-82765446 CAGTTAAAATAGAAGGAGTAGGG - Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143274459 17:5699834-5699856 CTGCAAGAAAAGAAGGAGGGGGG + Intergenic
1143373482 17:6454517-6454539 CTCCAATAACAGAAGGAAGACGG + Exonic
1143501913 17:7344109-7344131 CTGCTGAAACAGAAGGTGAGGGG + Exonic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1144937078 17:18908495-18908517 CTCCTGAAACACAAGGAGAAAGG + Intronic
1147538915 17:41340243-41340265 TTACTAAAACAGAAAGAGGAAGG - Intergenic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1154976293 18:21460728-21460750 TTGCTAAGAGAGAAGGATGAGGG - Intronic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1157167671 18:45373223-45373245 CTACTAAGAGAGAAGGAGAAGGG - Intronic
1157273526 18:46294363-46294385 CTGCCAAAAAAGAGGGAAGAGGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159148900 18:64494613-64494635 CTGATACAACAGAAGCAGAAGGG + Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1164775150 19:30847049-30847071 GTGCTAAAAAAGGTGGAGGAGGG - Intergenic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1166365939 19:42278554-42278576 CAGCCAAAACAGAAAGAGGGTGG - Intronic
926766991 2:16330544-16330566 TTCCTAAAGCAGAAGGAGGTGGG - Intergenic
929375576 2:41282774-41282796 CCACTAAAAAAGATGGAGGAGGG - Intergenic
929445852 2:42000647-42000669 CTGCTAAAGCAGAACCAGGAAGG + Intergenic
932295645 2:70621573-70621595 CTGCTAAGAGTGAAGGAGAAGGG - Intronic
933915242 2:86985081-86985103 CTGTTAAAACAGAACGATGAAGG - Intronic
934007751 2:87784820-87784842 CTGTTAAAACAGAACGATGAAGG + Intronic
935771388 2:106425739-106425761 CTGTTAAAACAGAACGATGAAGG + Intronic
935908685 2:107870210-107870232 CTGTTAAAACAGAACGATGAAGG - Intronic
935995090 2:108762428-108762450 CTGTTAAAACAGAACGATGAAGG - Intronic
936130468 2:109835324-109835346 CTGTTAAAACAGAACGATGAAGG - Intronic
936214229 2:110536161-110536183 CTGTTAAAACAGAACGATGAAGG + Intronic
936423366 2:112390720-112390742 CTGTTAAAACAGAACGATGAAGG + Intronic
937422419 2:121769107-121769129 CTGCTAAACCACAAGGGGGTCGG + Intergenic
937484726 2:122303194-122303216 CAGCTAAAACAGTAGTAAGAAGG + Intergenic
937709829 2:124967466-124967488 CTGCTAATACACAAGAAGAAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942417974 2:175778568-175778590 CTGGTATAACAGAAGGAAGCTGG - Intergenic
942624905 2:177889909-177889931 CTCCAAAAAAAGAAGTAGGAAGG - Intronic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
946598936 2:221338306-221338328 CTGCTAAACAAGAATGGGGAGGG + Intergenic
946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG + Intergenic
947212103 2:227717882-227717904 CTGCTAAGACCGAGGGATGACGG + Intronic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
947732221 2:232437559-232437581 CTGGTAAAAGAGACGGAGGCTGG + Intergenic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1174094047 20:48073840-48073862 CTCCCAGGACAGAAGGAGGATGG - Intergenic
1174872602 20:54197135-54197157 CTGCGAAGACATGAGGAGGAGGG - Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1178232849 21:30806986-30807008 CAGCTATAACAGGCGGAGGACGG + Intergenic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1181034793 22:20164738-20164760 CTGCTGAGACAGAAGGGGGCCGG - Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182349675 22:29692260-29692282 CTGCCCACACAGAAGTAGGAAGG - Intronic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951010997 3:17679254-17679276 CTCCTAAAACAGAAGGTAAATGG + Intronic
951283700 3:20783233-20783255 CTCCAAAAACATGAGGAGGAGGG + Intergenic
952915737 3:38239748-38239770 CTGATAAAACAGTACAAGGAAGG - Intronic
953466989 3:43130579-43130601 CTGCTAGAGCAGAAGAATGAAGG - Intergenic
954615150 3:51965783-51965805 CTGGTAAAACGGCAGGAGTAGGG - Intronic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
957951777 3:87136452-87136474 CTGCTAGATCTGAAGGGGGAAGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959422008 3:106140357-106140379 CAGCTAAAAGAAAAGGAAGAAGG + Intergenic
959967935 3:112377385-112377407 TTGCTCAAAAAGCAGGAGGAGGG - Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961281661 3:125769387-125769409 CTGCTATTAAAGAACGAGGATGG - Intergenic
961872698 3:130000205-130000227 CTGCTATTAAAGAACGAGGATGG + Intergenic
961945814 3:130686399-130686421 ATTCTAGATCAGAAGGAGGACGG - Exonic
962317631 3:134368670-134368692 CTACTAGAAGAGATGGAGGATGG - Intronic
962827007 3:139107654-139107676 CTGCTGATAGAGAAGGAGGTAGG + Intronic
963643166 3:147882448-147882470 CTCCTCAAACAAAAGGAGAAAGG + Intergenic
963684117 3:148415305-148415327 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
963818026 3:149855360-149855382 GTTCTAAAACAGAAGAAGTAGGG - Intronic
965389305 3:168085096-168085118 CTGCTAAACAAAAAGGAGGCAGG + Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968289792 3:197529922-197529944 CTGCTATAGAAGAAGGATGAAGG - Intronic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
969016009 4:4104698-4104720 CTGCTATTAAAGAACGAGGATGG + Intergenic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969737940 4:9003646-9003668 CTGCTATTAAAGAACGAGGATGG - Intergenic
969797136 4:9535200-9535222 CTGCTATTAAAGAACGAGGATGG - Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970323265 4:14896779-14896801 GTGCTGAGAGAGAAGGAGGAGGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971027534 4:22603224-22603246 TGGCTAAAACAGAAGAAAGAGGG + Intergenic
971218070 4:24680487-24680509 CTGCTGAAAAAGAGGGAGAAGGG + Intergenic
972229770 4:37058084-37058106 CTGCTGAAACAAAAGGAGGCAGG + Intergenic
972613170 4:40673837-40673859 CTGCTAAAGCAGAAAGCGGCAGG - Intergenic
973303585 4:48617630-48617652 GTGTTAAAAGAGGAGGAGGAGGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974499116 4:62675322-62675344 CTTCAAAAACTTAAGGAGGATGG - Intergenic
974891526 4:67890017-67890039 CTGCTAAAACAGGAAGAATATGG - Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
977013159 4:91659485-91659507 CTGCTAACAGTGAAGGAGAAGGG + Intergenic
978252236 4:106645883-106645905 ATTCTAAAATATAAGGAGGAAGG - Intergenic
978498335 4:109384038-109384060 CTGCCAACACAGAAGGGGGTGGG - Intergenic
978667772 4:111206799-111206821 CTGATATAACAGAAGGAGCTTGG - Intergenic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979146413 4:117253060-117253082 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
984551334 4:181163184-181163206 TTGCTAAATTAGAAGGAAGATGG - Intergenic
984876333 4:184371257-184371279 CTGGTAAAACAGAAAGGGAAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985586723 5:743437-743459 CTGCTAAAACAGAAGCCTGCTGG + Intronic
985601306 5:835624-835646 CTGCTAAAACAGAAGCCTGCTGG + Intronic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
985916033 5:2919839-2919861 CTGCTAACTCAGTAGGGGGAGGG - Intergenic
986088116 5:4473572-4473594 CTGCTAAAAGGAAAGGAAGAAGG - Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
987236467 5:15947113-15947135 CTGCTAAGACAGAAGAATGGTGG - Intergenic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
988642673 5:33058644-33058666 TGGCTAAATCAGAAGGAGCAAGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
991166357 5:63568364-63568386 CAGCTAAATCAGAAGGGAGAGGG + Intergenic
991365780 5:65866561-65866583 CAGCCAAAACAGAAACAGGAGGG + Intronic
991560229 5:67943369-67943391 CTGCTAAAAAATAAGGGGGGGGG - Intergenic
993148603 5:84130088-84130110 ATACTCAAACAGAAAGAGGAGGG - Intronic
993993611 5:94691345-94691367 CTGATAGAACAGAAGCAGTATGG + Intronic
994034355 5:95181407-95181429 CTGCTAAGATTGAAGGAGGTGGG - Intronic
995448068 5:112268469-112268491 ATGCCAATAGAGAAGGAGGAGGG - Intronic
995488310 5:112661965-112661987 TTGCCAAAACATAAGGAGAAAGG + Intergenic
996221303 5:120936410-120936432 GTGTTAAAACATAAGTAGGATGG - Intergenic
996702512 5:126464588-126464610 TTGGTAAAAGAGAAGGTGGAAGG - Intronic
997392981 5:133532096-133532118 CTTCTAAAAGAGAGGCAGGAGGG + Intronic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999662792 5:153883133-153883155 ATGCTAACAGAGAAGGAGGCAGG - Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000712077 5:164592802-164592824 TTGATAAAATAGAAGGATGAAGG + Intergenic
1002655405 5:180742534-180742556 CTGCTAAACCAGAAGCAGGTCGG - Intergenic
1002789563 6:427381-427403 CTGCTAAGACCAAAGGTGGAAGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1004105995 6:12668134-12668156 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1004106028 6:12668255-12668277 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1004993522 6:21165163-21165185 CTCCTGAAACAGAAAGTGGAAGG - Intronic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1007037049 6:38684971-38684993 GTGGTAAGAAAGAAGGAGGAAGG + Intronic
1007077183 6:39075280-39075302 CTGCTAGAGCAGGAGGAGGGAGG + Intronic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008580801 6:52904800-52904822 CTGCTCAAACACTGGGAGGATGG + Intronic
1010087767 6:71940635-71940657 CTGCTAAAACAAAATGCAGAAGG + Intronic
1010179657 6:73071052-73071074 CATCTAAAACAGGAGGGGGATGG + Intronic
1010935956 6:81861623-81861645 GTGCTCACACAGAAGCAGGAAGG + Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013989414 6:116236379-116236401 CTGCTTTAACAGGAGTAGGAAGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016999850 6:149989014-149989036 CTTCTATAACAGCAGGAGGATGG - Intergenic
1017000235 6:149991429-149991451 CTCCTATAACAGCAGGAGGATGG + Intergenic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018472785 6:164111465-164111487 CTGCTAAAAAGGAGGGAGGGAGG + Intergenic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019443370 7:1058611-1058633 CTGCTGGAAGAGAAGCAGGAGGG + Exonic
1020960092 7:14791584-14791606 CTGATAAAACAGAAAAAGAAGGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022925309 7:35050691-35050713 CTACTAAAACAGAATTATGATGG - Intergenic
1023085848 7:36569237-36569259 TTGCTAAAACAAAATGAGGAAGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024135839 7:46407066-46407088 CTCCTAAAACAGAGGGAGCCTGG + Intergenic
1026238846 7:68554203-68554225 CTCCTAAAACAAATGGAAGAAGG - Intergenic
1026298775 7:69079070-69079092 GTGCCAAAAAAGATGGAGGAGGG + Intergenic
1026575398 7:71567273-71567295 CTGCTACACCAGCAGGAGCAAGG + Intronic
1027265462 7:76492860-76492882 CTGCTAAAACAGAATGGGTGTGG - Intronic
1027316833 7:76990977-76990999 CTGCTAAAACAGAATGGGTGTGG - Intergenic
1027526718 7:79278443-79278465 CTGCCAAAACAAAAGGGGAAAGG - Intronic
1028858961 7:95625692-95625714 CTGCTAAAACAAATAGGGGAAGG + Intergenic
1029074678 7:97926341-97926363 CTGCTATTAAAGAATGAGGATGG + Intergenic
1029369295 7:100137880-100137902 TTGCAAAAACTGAGGGAGGAAGG + Intergenic
1029823324 7:103165389-103165411 CTACTAAAACAGAATTATGATGG - Intergenic
1031042051 7:116848989-116849011 CTGCTGAAATAGAAGTAGGGTGG + Intronic
1031623664 7:123967671-123967693 CTGCTAAAATGCAAGAAGGAAGG + Intronic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1036829697 8:12012237-12012259 CTGCTATTAAAGAACGAGGATGG + Intergenic
1036900046 8:12663537-12663559 CTGCTATTAAAGAACGAGGATGG + Intergenic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1038186603 8:25280738-25280760 TTGCTAAATCACAAGGAGGATGG + Intronic
1038236545 8:25763172-25763194 CTTCTAAAAAAGAAGAAGGGTGG - Intergenic
1039592729 8:38763451-38763473 ATGCTAAAACAAAATGAGGCCGG - Intronic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1041528179 8:58832638-58832660 CTGCTAAATTAGAAGCAGCAGGG - Intronic
1042640834 8:70932469-70932491 CTGTTAGAAGAGAAGGAGGTAGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1045149651 8:99389902-99389924 CATCTAAAACATAAGGAGGGGGG - Intronic
1045342364 8:101266316-101266338 CTGCTAGAGCAGAAGGTGTATGG + Intergenic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050282165 9:4061863-4061885 CTGATAAACCAGGAGGAGCACGG - Intronic
1051777117 9:20647108-20647130 TTACTAAAACAAAAGGAGAAGGG - Intergenic
1052972093 9:34382813-34382835 CTGGTACAACACATGGAGGATGG - Exonic
1054840335 9:69731621-69731643 CTACTAAAGCAGAATGAGGGTGG - Intronic
1056522230 9:87411887-87411909 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1059635478 9:116166213-116166235 CTTCCAAAACAGAAGGGGAAGGG + Intronic
1060448303 9:123712657-123712679 CTGTTATAACAGAAGCAGGGAGG - Intronic
1203769338 EBV:40948-40970 CCATTAAAACGGAAGGAGGAAGG - Intergenic
1203789616 EBV:143867-143889 CCATTAAAACGGAAGGAGGAAGG - Intergenic
1190560034 X:51677972-51677994 CTACAAAAAAAGTAGGAGGAGGG - Intergenic
1190564257 X:51715349-51715371 CTACAAAAAAAGTAGGAGGAGGG + Intergenic
1194813150 X:98411147-98411169 CAACTAAAACACAATGAGGAGGG - Intergenic
1195652605 X:107300846-107300868 CTGTTAAAACATGAGGTGGAGGG - Intergenic
1196165322 X:112531525-112531547 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196276359 X:113769966-113769988 TTGCTAAAACAGTAGCAGGGAGG + Intergenic
1196319733 X:114272290-114272312 CTTCTAAAACAGGAGGCAGATGG - Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1196907190 X:120449287-120449309 TGGCTAAAACATAAGGAGTAAGG + Intronic
1197758828 X:130014006-130014028 CTACTCAAACTGAAGGAGGCCGG - Exonic
1197932866 X:131713001-131713023 CTGCTAAGAGTGAAGGAGAAGGG - Intergenic
1199901516 X:152177217-152177239 CAGTTAAAACAGGAGGTGGACGG + Intronic