ID: 1131304138

View in Genome Browser
Species Human (GRCh38)
Location 15:91226341-91226363
Sequence CACTCTGTGCATCTTCTTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131304138_1131304141 1 Left 1131304138 15:91226341-91226363 CCCAGAAGAAGATGCACAGAGTG 0: 1
1: 0
2: 2
3: 29
4: 275
Right 1131304141 15:91226365-91226387 TGTCACCGAAGGCCATGATGAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1131304138_1131304144 19 Left 1131304138 15:91226341-91226363 CCCAGAAGAAGATGCACAGAGTG 0: 1
1: 0
2: 2
3: 29
4: 275
Right 1131304144 15:91226383-91226405 TGAGGAAGACGAGATCTATGAGG 0: 1
1: 0
2: 0
3: 17
4: 152
1131304138_1131304145 20 Left 1131304138 15:91226341-91226363 CCCAGAAGAAGATGCACAGAGTG 0: 1
1: 0
2: 2
3: 29
4: 275
Right 1131304145 15:91226384-91226406 GAGGAAGACGAGATCTATGAGGG 0: 1
1: 0
2: 1
3: 10
4: 128
1131304138_1131304140 -10 Left 1131304138 15:91226341-91226363 CCCAGAAGAAGATGCACAGAGTG 0: 1
1: 0
2: 2
3: 29
4: 275
Right 1131304140 15:91226354-91226376 GCACAGAGTGATGTCACCGAAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131304138 Original CRISPR CACTCTGTGCATCTTCTTCT GGG (reversed) Exonic
900560948 1:3305945-3305967 CACTCTCTGCATCCTCCTCAAGG + Intronic
901769486 1:11523004-11523026 CTCCCTGTGCCTCTTCCTCTGGG + Intronic
901913709 1:12481277-12481299 CACTATGTGCCTTTTCTACTTGG - Intronic
905098578 1:35497870-35497892 CACACTGTTCTTCTACTTCTGGG - Intronic
906279653 1:44544339-44544361 CACCCTGTTCCTCTTGTTCTTGG + Intronic
907271651 1:53294935-53294957 TGCTCTGTGCAGCTTCCTCTTGG + Intronic
907747222 1:57225078-57225100 CACTCTGTGTATCTTTTCCTGGG + Intronic
908146080 1:61245732-61245754 CTCTCTGTGTATCTACTTCATGG + Intronic
909395053 1:75161866-75161888 AACTCTTTGCATTTTCTTCTTGG + Intergenic
910117219 1:83745198-83745220 CACTCTGTGTATCTCATTCTGGG + Intergenic
910353188 1:86323433-86323455 CACTCTCTGCATGCTCTGCTTGG + Intergenic
910671025 1:89772876-89772898 CACTCTGTGTACTATCTTCTTGG + Intronic
911241245 1:95470175-95470197 CAATCTGTGCCTGTCCTTCTTGG + Intergenic
911241549 1:95472779-95472801 CACTCTTTACATCTTGTGCTGGG + Intergenic
911448149 1:98026388-98026410 CATTCAGTGCATCTACTTGTTGG - Intergenic
911666217 1:100556226-100556248 CTCTCTCTGCATCTTCTTTAAGG + Intergenic
911922589 1:103784597-103784619 AACTCTGTGCATCTTTCACTAGG - Intergenic
913148114 1:116012249-116012271 TACTCTGAGCAACTTCTCCTTGG - Intronic
915559856 1:156680707-156680729 CCATCTGGTCATCTTCTTCTGGG - Intergenic
916168477 1:161983642-161983664 CCCTCTGTGCTTCTGCTTGTGGG + Exonic
918807290 1:189065344-189065366 CACTCGGTACAACTTCCTCTAGG + Intergenic
918883222 1:190154421-190154443 GACTTTGTGCATCTTCTGATAGG - Intronic
919493036 1:198229062-198229084 CTGTCTGTTCAGCTTCTTCTTGG - Intronic
919917349 1:202146987-202147009 CCTTCTTTCCATCTTCTTCTTGG - Intergenic
921390600 1:214609443-214609465 CACTTTGTCCCTCTTCCTCTGGG - Intronic
922060775 1:222089165-222089187 CAGTATGTGCATATGCTTCTTGG - Intergenic
922251930 1:223857096-223857118 CACACTGCGCATCCTCTTCTGGG - Intergenic
922864045 1:228843478-228843500 TACTCTGTGCATATTCCTCTTGG + Intergenic
1063230822 10:4064228-4064250 CATTCTGTGATTCTTCTTCGAGG + Intergenic
1066659955 10:37728870-37728892 CACTCCCTGCATCCTGTTCTAGG + Intergenic
1067008721 10:42690692-42690714 CACTCCCTGCATCATGTTCTAGG - Intergenic
1067728876 10:48794551-48794573 CTCTCTGTACAGCTTCTTTTTGG - Intronic
1067940913 10:50654852-50654874 CTGTCTGTGCACCTTCTTCTGGG - Intergenic
1069332890 10:67314095-67314117 AATTATGTGCATCTTCTTTTTGG - Intronic
1071162921 10:82772257-82772279 TACTCTGTTTATCTGCTTCTAGG + Intronic
1071480982 10:86064748-86064770 CACTCAGAGCATCTTATTCCAGG + Intronic
1073029160 10:100511010-100511032 CACCCTCTGCATCTTCATGTGGG - Intronic
1073189582 10:101641591-101641613 CACTATGTGAATTTTCTGCTTGG - Intronic
1073634064 10:105179178-105179200 AACTCATTGCATCTTCTTTTGGG + Intronic
1075623942 10:123948346-123948368 CCATCTGTGCCTCTGCTTCTGGG - Intergenic
1076248605 10:128966962-128966984 CTCTCTGTTCCTCTTCCTCTGGG - Intergenic
1076508613 10:130996456-130996478 CACTCTCTGCTTCTTCTGCGGGG + Intergenic
1078001269 11:7498205-7498227 CATTCTGTGCAACCCCTTCTAGG - Intronic
1078257911 11:9675766-9675788 CAATCTGTGCACCTTCTACCGGG + Intronic
1078852284 11:15175843-15175865 CACCCTGTGCATCCTCTTCCAGG - Exonic
1081748774 11:45492467-45492489 CACTCTGTCTATTTTCTTCATGG - Intergenic
1081783893 11:45732991-45733013 CACTCTCTGAGGCTTCTTCTGGG - Intergenic
1083115741 11:60457596-60457618 CTCTCAGTCCATCTTCATCTTGG - Intronic
1083968772 11:66059543-66059565 CATTCGGCGCAACTTCTTCTTGG - Exonic
1083996583 11:66276055-66276077 CTCTCTGGGCATCCCCTTCTTGG + Exonic
1085608078 11:77921140-77921162 CACTGTGTGCAGCTTGTTTTTGG - Intronic
1087943041 11:104124152-104124174 CACTCTGTACATTTTCTTAGGGG - Intronic
1088639736 11:111860045-111860067 TTCTATGTGCATCTTCTGCTGGG - Intronic
1088795752 11:113265543-113265565 CACTCTGTGCAGCCTCTGTTAGG - Intronic
1090031089 11:123207106-123207128 CACTCTGTGTCTCTCCCTCTGGG + Intergenic
1091320635 11:134646877-134646899 CACTCTGAGCCTCCTCTCCTGGG + Intergenic
1093101977 12:15038489-15038511 CCCTCTCTGCACCCTCTTCTGGG - Intergenic
1093102163 12:15040343-15040365 CTTCCTGTGCATCTTCCTCTTGG + Intergenic
1094821626 12:34230738-34230760 CACCCTGCCCATCTGCTTCTTGG - Intergenic
1095069019 12:37816050-37816072 CACTCTGAGAAACTTCTTTTTGG + Intergenic
1095107964 12:38258508-38258530 CCCTCTTGGCATCTGCTTCTTGG + Intergenic
1095564101 12:43600570-43600592 GACTCTGATCATTTTCTTCTGGG - Intergenic
1095710321 12:45281438-45281460 CACTGTTGGCATCTGCTTCTAGG + Intronic
1097257191 12:57687590-57687612 AAATATGTGCATCTACTTCTGGG - Intergenic
1098706385 12:73695848-73695870 CACTCTGTGGCTTCTCTTCTTGG - Intergenic
1100060784 12:90573191-90573213 CAGTCTATGCATCTCCTTATAGG + Intergenic
1100743939 12:97624968-97624990 CTCTCTGTCTCTCTTCTTCTAGG + Intergenic
1101020329 12:100547313-100547335 CTCTGTGTGCATCTAATTCTAGG - Intronic
1102703329 12:114859453-114859475 GACTCAGTGTATCTTCCTCTAGG - Intergenic
1102881021 12:116485064-116485086 CTCTCTGTGCATCTGTTTCCTGG + Intergenic
1105274457 13:18906475-18906497 CACTCCCTGCATCCTGTTCTAGG + Intergenic
1105908957 13:24842639-24842661 CACTCTATTCTTCTGCTTCTGGG - Intronic
1108256169 13:48613090-48613112 CTGTCTGTGCAGATTCTTCTTGG + Intergenic
1108504419 13:51098218-51098240 CAGTCTGTTCATTTTCTTCTGGG + Intergenic
1108571369 13:51755072-51755094 CACTCTGTGCTTCTCCCTCTTGG + Intronic
1109124771 13:58504726-58504748 CTCTCTGTGCCTCTTCTGCCTGG - Intergenic
1114051382 14:18921601-18921623 CACTCTCTGCATCCCATTCTAGG + Intergenic
1114111179 14:19480324-19480346 CACTCTCTGCATCCCATTCTAGG - Intergenic
1116150067 14:41129440-41129462 CACTATGTGCCTCATCTTCAAGG + Intergenic
1116435433 14:44890600-44890622 TACTTTGAGCATCTTCTGCTGGG + Intergenic
1118504995 14:66401572-66401594 CTCTTTGTTCATCTTCTTCTGGG + Intergenic
1119159084 14:72438294-72438316 CTCTCTCTGCATTTTCTCCTTGG + Intronic
1119965915 14:78915661-78915683 CCCTCTGTGCAGCTTCTTGATGG + Intronic
1120650775 14:87130254-87130276 CATTCTGTAAATCTTCTTTTTGG - Intergenic
1120684586 14:87523623-87523645 CACTGTTTACATCTTCTTTTTGG + Intergenic
1121447831 14:93989296-93989318 CAGTCTGTGCTTCTTATCCTGGG - Intergenic
1122815925 14:104314054-104314076 CACTCTCTAGGTCTTCTTCTCGG + Intergenic
1124183423 15:27499966-27499988 CACACTGTGCATCCTCTGCCAGG - Intronic
1124960865 15:34393237-34393259 CACTCTCTGCATTTAGTTCTTGG + Intronic
1124977493 15:34539458-34539480 CACTCTCTGCATTTAGTTCTTGG + Intronic
1129707743 15:77804400-77804422 CTCTCTGGCCATCTACTTCTAGG - Intronic
1130878429 15:88033885-88033907 CACCCTGTACCTCCTCTTCTAGG + Intronic
1131304138 15:91226341-91226363 CACTCTGTGCATCTTCTTCTGGG - Exonic
1132224992 15:100133506-100133528 AATTCTGTGCATCTACTCCTAGG + Intronic
1133823599 16:9258356-9258378 GAAGCTGTGCATCTTCTTCCTGG - Intergenic
1134349969 16:13428116-13428138 CACAGTTTGCATCTTCTTATTGG - Intergenic
1135038663 16:19100142-19100164 CACTCAGTGAAGCTGCTTCTAGG - Intergenic
1135616637 16:23916545-23916567 CACTCTGTTCACCTCCTTTTTGG + Intronic
1135758753 16:25119305-25119327 CACCCTGTTCATCTTCTTGGTGG + Intronic
1135832583 16:25789144-25789166 CTCTCATTTCATCTTCTTCTGGG - Intronic
1135852837 16:25980202-25980224 CCCTGTGTGCAGCTTCATCTGGG + Intronic
1138471299 16:57239510-57239532 CAGTCTGTGCACCTTCTTTCAGG - Exonic
1139436930 16:66941787-66941809 CTCTCTGTCCATTTCCTTCTGGG - Exonic
1139493806 16:67301630-67301652 CAGGCTGTGAATCCTCTTCTTGG + Intronic
1140925340 16:79577211-79577233 CATTATATGCATTTTCTTCTGGG + Intergenic
1142196189 16:88740348-88740370 GACTCTGGTCATCTTCATCTTGG - Intronic
1142340413 16:89518524-89518546 CACTCTGTGTAATTCCTTCTGGG - Intronic
1143870922 17:9956868-9956890 CGCCCTGAGCATCTCCTTCTTGG + Intronic
1144523190 17:15967969-15967991 CTCTCTGTGCGGCTCCTTCTAGG + Intronic
1146138853 17:30347343-30347365 CTCTCTGGGCACCATCTTCTAGG - Intergenic
1146450523 17:32970460-32970482 CACACTGTCCACCTTTTTCTCGG - Intronic
1147349770 17:39832384-39832406 CACTTTTTGCATATTGTTCTTGG - Intronic
1149216696 17:54363449-54363471 AAATCTGTTCATTTTCTTCTAGG + Intergenic
1149944538 17:60908232-60908254 CTCTCTGTGGATCTTTTTCCTGG + Intronic
1154170293 18:12046523-12046545 CACTCCCTGCATCCTCCTCTAGG - Intergenic
1154175638 18:12086207-12086229 CACCCTTTGCATCTTCCTCTAGG + Intergenic
1154415809 18:14174662-14174684 CACCCCTTGCATCTTCCTCTAGG - Intergenic
1154486572 18:14876385-14876407 GACTCTGAGAATTTTCTTCTTGG - Intergenic
1155041869 18:22071577-22071599 CAGTCTCTGCCTCTTCTTCCAGG + Intergenic
1155734984 18:29210536-29210558 CTATCTGTTCATATTCTTCTTGG - Intergenic
1155769786 18:29681966-29681988 CCCTCTGGGTATCTGCTTCTTGG + Intergenic
1156167948 18:34446244-34446266 CTCTCCGTGCAGCTTCATCTTGG + Intergenic
1156385531 18:36601404-36601426 TACTGTGTGCATCTGCTTCCTGG + Intronic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1157428643 18:47604959-47604981 CGCTCAGTTCATCTTCTACTGGG - Intergenic
1159279080 18:66260766-66260788 CTCTCTGTTCAGATTCTTCTTGG - Intergenic
1161471488 19:4458985-4459007 CACTTTGTGTATCTTCTTTGTGG - Intergenic
1161889081 19:7020757-7020779 CACTCTGTTGATTTTCATCTTGG + Intergenic
1161890271 19:7031209-7031231 CACTCTGTTGATTTTCATCTTGG - Intronic
1161891177 19:7039524-7039546 CACTCTGTTGATTTTCATCTTGG + Intronic
1161892372 19:7049992-7050014 CACTCTGTTGATTTTCATCTTGG - Intronic
1161893262 19:7057985-7058007 CACTCTGTTGATTTTCATCTTGG + Intronic
1164578290 19:29418830-29418852 CACCATGTGCAGCTTCTCCTGGG - Intergenic
1165560274 19:36673144-36673166 CAGACTTTGCATCCTCTTCTGGG + Intergenic
1165566433 19:36732831-36732853 CAATCTGTGCATATTTTTATAGG - Intronic
1167451715 19:49574276-49574298 CACTCTCTTCAACTGCTTCTTGG + Intronic
925787810 2:7449896-7449918 CACTGTATACATCTACTTCTTGG + Intergenic
926433632 2:12816365-12816387 CACTCTGGGAATGTTCTTCTAGG - Intergenic
926574216 2:14562557-14562579 CTCTCTGAGCTACTTCTTCTAGG - Intergenic
926966157 2:18414171-18414193 CACTCTGTGGATCCTATTCCAGG + Intergenic
927967884 2:27282976-27282998 CACTCTATCCATCACCTTCTGGG - Intronic
930219592 2:48732944-48732966 CACACTGTCCCTGTTCTTCTCGG - Intronic
931865963 2:66412261-66412283 CTCTCTGTGCCCCTTCATCTGGG + Intergenic
932827669 2:74956680-74956702 CTGTCTGTTCATATTCTTCTTGG - Intergenic
937707954 2:124942916-124942938 CCCTATCTGCAGCTTCTTCTAGG + Intergenic
937774448 2:125759379-125759401 CACTTTGAATATCTTCTTCTGGG - Intergenic
939109866 2:137993559-137993581 CATTCTCTCCATCTCCTTCTTGG - Intronic
941495243 2:166192361-166192383 CATTCAGTGCACCTTATTCTTGG - Intergenic
941608415 2:167629938-167629960 CTCTCTGGGCATTTTTTTCTTGG + Intergenic
942912148 2:181257277-181257299 CATACTGTACATTTTCTTCTTGG - Intergenic
944218770 2:197281435-197281457 CTCTCTGTCCATTTTCTTCTTGG + Intronic
944474435 2:200089251-200089273 CATTATGTGCATCCTCTCCTGGG + Intergenic
945994734 2:216426424-216426446 CATTATGTGCATTTTTTTCTGGG - Intronic
947041008 2:225919664-225919686 CACTCTTTTCTTCTTTTTCTAGG + Intergenic
948644693 2:239397198-239397220 CTCTCCGTGCCTCTGCTTCTAGG - Intronic
1169883449 20:10372226-10372248 CTCTTTGTTCAGCTTCTTCTTGG - Intergenic
1171563310 20:26149977-26149999 CTCTTTATGCATCTTCTTCTGGG + Intergenic
1172274319 20:33671512-33671534 CACTCTTTGCCCCTTCTCCTTGG - Intronic
1173062417 20:39675099-39675121 CATTCTGTGGATCTGATTCTGGG + Intergenic
1173205486 20:40990045-40990067 CACGCTGTGTATATTCTTTTCGG - Intergenic
1173217616 20:41100728-41100750 CACTCTGTGCAGCTTCTGTATGG + Intronic
1173831588 20:46092286-46092308 CACTCAGTGGATCTTCCACTGGG - Intergenic
1175056730 20:56205525-56205547 CTGTCTGTGCAGATTCTTCTTGG - Intergenic
1176857531 21:13984642-13984664 CACCCCTTGCATCTTCCTCTAGG + Intergenic
1176867075 21:14059580-14059602 CACCCCTTGCATCTTCCTCTAGG - Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177448221 21:21226812-21226834 CACACTGTCCATCTTCACCTAGG + Intronic
1180127999 21:45805111-45805133 CACTCTGGGCATCGTCATCTTGG + Intronic
1180469855 22:15643976-15643998 CACTCTCTGCATCCCATTCTAGG + Intergenic
1181989829 22:26829040-26829062 CACTCACTGCTTCCTCTTCTTGG - Intergenic
1182686425 22:32123872-32123894 CACTCTCTGCATCCCGTTCTAGG + Intergenic
1182697602 22:32207114-32207136 CACTCTCTGCATCCTGTTCTAGG + Intergenic
1182715269 22:32353014-32353036 CACTCTCTGCATCCTGTTCTAGG - Intergenic
1182944826 22:34312107-34312129 CACTCTTTCTAGCTTCTTCTCGG - Intergenic
1183780759 22:39997492-39997514 CACACCGTGTATCTTCTTCATGG - Intronic
1184031472 22:41897432-41897454 CACTCATTGCTTGTTCTTCTGGG - Intronic
950545032 3:13633262-13633284 CCGTCTCTGCATCCTCTTCTTGG + Intronic
951261254 3:20512206-20512228 CACTCACTGGATCTCCTTCTTGG - Intergenic
951782343 3:26377810-26377832 CACACTCTGTATCTTCATCTGGG + Intergenic
952046777 3:29331212-29331234 CACTCCCTTCATCTGCTTCTGGG + Intronic
952794104 3:37223727-37223749 CACTCTCAGCATCTGCTTCTGGG + Intergenic
955286652 3:57647874-57647896 CACTCTCTGATTCTTCTTGTTGG - Intronic
955705696 3:61725517-61725539 TACTCTGTGGGTCTCCTTCTGGG + Intronic
958787607 3:98614845-98614867 AAGACTTTGCATCTTCTTCTGGG + Intergenic
960085537 3:113586704-113586726 CACAATGTCCATCTTCTCCTTGG - Intronic
961435990 3:126916927-126916949 CCCCCAGTGCATCTTCTCCTTGG - Intronic
961540474 3:127595982-127596004 CACTGGGTGCCTCTTCTTCAAGG - Intronic
962209534 3:133465569-133465591 GACTCTGTCCATCTTGCTCTGGG + Intronic
962665369 3:137648943-137648965 CAAACTGTTCCTCTTCTTCTAGG + Intergenic
963276305 3:143333657-143333679 CACTTTGTGCATTCTGTTCTTGG - Intronic
963912332 3:150825519-150825541 CACACTGTCCATCTTTATCTTGG + Intergenic
964943004 3:162184784-162184806 CACTCTTTACATCTTCTCCCTGG + Intergenic
965854175 3:173067656-173067678 CCCTCTCTACATCTTCTTCAAGG - Intronic
966311493 3:178599115-178599137 CACTATGTTAATCTTCTACTTGG - Intronic
967820291 3:193833690-193833712 CACGCCGTGCATCTTCCTCTGGG - Intergenic
969086160 4:4658029-4658051 AACTCTGTGCATCTCCTCCGAGG - Intergenic
969859699 4:10025924-10025946 CACTTTCTTCATCTTCTCCTCGG + Intronic
970233316 4:13933243-13933265 TATTCTGTGCAACTTCTTCCTGG - Intergenic
970320404 4:14869826-14869848 CACTTTGTGCATTTTCTTGCAGG - Intergenic
972291094 4:37690648-37690670 TACTCTCTGCAGCTTCTTTTGGG + Intergenic
973134047 4:46683776-46683798 AACACTGTGCATCTTCTGCTAGG + Intergenic
975459182 4:74630478-74630500 CAGTCTTGGCATCTGCTTCTTGG + Intergenic
975941775 4:79656761-79656783 CACTCTGTGCCTCTTCAGCGGGG + Intergenic
978266158 4:106827487-106827509 CACTCTCTTTGTCTTCTTCTGGG - Intergenic
979186898 4:117807938-117807960 TAGTCTGTCCATATTCTTCTTGG - Intergenic
979191883 4:117871575-117871597 CAATCTTGGCATCTGCTTCTTGG - Intergenic
980800911 4:137749012-137749034 GTCTCTGTGCATGTTCTGCTAGG + Intergenic
982658532 4:158178386-158178408 CTCTCTGTGCAGCTACTTATGGG - Intergenic
984920960 4:184763970-184763992 CAGTCTGTGAATCTTCTTTATGG - Intronic
985610241 5:883868-883890 CTCTGTGTGCCTCTCCTTCTGGG - Intronic
986344764 5:6824094-6824116 CACTCTGTGCTGCGACTTCTCGG + Intergenic
987011764 5:13773732-13773754 CACTCTGTGCTTTTTCTTCTTGG - Intronic
987779165 5:22410444-22410466 CTCTCTGTGCAGATTCTTCTTGG - Intronic
988722456 5:33892188-33892210 CGCTCGGTGCATCTTCCTCCCGG + Exonic
989034842 5:37159583-37159605 AACTCTGTGCCTTTTGTTCTAGG + Intronic
990149407 5:52799947-52799969 CACTCTGTGCACCTTCTTGAGGG + Exonic
991190801 5:63871010-63871032 CTCTGTGTGCATCTTCTTCATGG - Intergenic
991979340 5:72215362-72215384 CACTCTGTGTGTCTTGTTCATGG - Intergenic
992889550 5:81191359-81191381 CTCTAAGTGCATCTTCTCCTTGG + Intronic
994045871 5:95309051-95309073 CTCTCTGTTCAGATTCTTCTTGG - Intergenic
996220919 5:120932238-120932260 TACTCTGTGCATTTTCTTCTAGG - Intergenic
996269524 5:121585860-121585882 AACTCTCTTCCTCTTCTTCTTGG + Intergenic
997299599 5:132792888-132792910 CAGTCTGTGCCCCTTCTTCAAGG - Intronic
998238496 5:140421204-140421226 AATTCTGTCCATATTCTTCTTGG - Intronic
998297840 5:140988541-140988563 GACTTTCTTCATCTTCTTCTTGG + Intronic
998507169 5:142681390-142681412 CACTCTGTTTATTTTGTTCTTGG + Intronic
998547188 5:143039557-143039579 AACTCTGTACATTTTATTCTCGG - Intronic
1000386321 5:160677841-160677863 CAATCAGTTCATCTTCTTTTGGG + Intronic
1003352333 6:5329746-5329768 CACCCTGTGTATCTCCTCCTGGG - Intronic
1005802801 6:29444457-29444479 AACTCTTTGCATCATCTTTTTGG + Intronic
1008341883 6:50376344-50376366 ATCTCTCTGCCTCTTCTTCTAGG + Intergenic
1009507025 6:64497456-64497478 CACTGTGCCCATCTGCTTCTGGG - Intronic
1009888330 6:69651606-69651628 GACTATGTGCATGTTCTTTTTGG - Intergenic
1011239546 6:85256339-85256361 CACTCTGTGCATCAGCATCCTGG - Intergenic
1013021642 6:106227003-106227025 CTTTTTCTGCATCTTCTTCTGGG - Intronic
1013110840 6:107063736-107063758 TACTCTGTGAATGTTCTTTTTGG + Intergenic
1014596841 6:123354188-123354210 CATTCATTGCTTCTTCTTCTAGG - Intronic
1015103859 6:129513194-129513216 CACTGTGTGATTTTTCTTCTTGG - Intronic
1015978571 6:138816175-138816197 CACTTTGTGCATCATGTTCTAGG + Intronic
1016806277 6:148215488-148215510 CACTCTGGGCTTCTTCTGTTTGG + Intergenic
1017789716 6:157786368-157786390 CTATCTTTGCATCTACTTCTTGG + Intronic
1020901215 7:14005606-14005628 CTGTCTGTTCATATTCTTCTTGG - Intergenic
1023844621 7:44113709-44113731 CACTCAGTGCAACTTCATCCTGG + Exonic
1025844822 7:65186688-65186710 CACTGTGTGCAGCTTGTTTTTGG + Intergenic
1027725703 7:81802922-81802944 CATTTTGTGCTTTTTCTTCTTGG + Intergenic
1029435421 7:100561640-100561662 CCCTCTGTGCTTTTTCTTTTTGG + Intronic
1030079130 7:105762325-105762347 AGCACTGTGCATCTCCTTCTAGG - Intronic
1030141912 7:106312940-106312962 CCCTCTGTGCATCTTCTAAGTGG + Intergenic
1031821431 7:126506826-126506848 CTCTCTGTGCTTCCTCTGCTAGG + Intronic
1032438130 7:131919289-131919311 CCCTCTATGCAGCTTCTTCTGGG + Intergenic
1032716362 7:134512358-134512380 CAGTCTGTTCAGATTCTTCTTGG + Intergenic
1034120527 7:148622895-148622917 CACTCTCAGAATCTTCCTCTTGG - Intergenic
1035074899 7:156170722-156170744 CACTCCGCACATCTGCTTCTAGG - Intergenic
1038036132 8:23688430-23688452 CAGTCTGTGCCCCTGCTTCTAGG - Intergenic
1038636604 8:29292536-29292558 GAGTCTCTGCATCTTCTTCAGGG - Intergenic
1038770832 8:30478037-30478059 CACTGTGTTTATCTTCCTCTGGG - Intronic
1039192877 8:34996924-34996946 ATATCTGTGAATCTTCTTCTGGG + Intergenic
1039353404 8:36788186-36788208 CACTTTGGGCATCATCTTCTCGG + Intronic
1040135206 8:43845294-43845316 CTCTCTGTGAAACTTCTTCATGG + Intergenic
1040514254 8:48121651-48121673 AAATCTGTGCAACTTCTCCTGGG + Intergenic
1040870824 8:52098834-52098856 CACTGTGTGCAATTTCTTCAGGG - Intergenic
1040896683 8:52375513-52375535 CACTCTGTTGTTTTTCTTCTTGG + Intronic
1041390391 8:57342666-57342688 CTCTCTCTGCACCTTCTCCTGGG - Intergenic
1041759514 8:61349174-61349196 CACTCTGTTCATTGTCTCCTTGG + Intronic
1041851778 8:62401543-62401565 CAGTCTGTGCCCATTCTTCTTGG + Intronic
1042022560 8:64383701-64383723 CACTCTGTTTATTTTCTCCTGGG - Intergenic
1043498755 8:80832159-80832181 TACACTGTTTATCTTCTTCTAGG - Intronic
1043987398 8:86709879-86709901 CACTTTGTGATTCCTCTTCTAGG + Intronic
1046784735 8:118253870-118253892 CATTCTGGGCATTTTCTTCTTGG - Intronic
1047168764 8:122468910-122468932 CACTCTGTGCATTTTATTTGGGG - Intergenic
1048278877 8:133089896-133089918 GATTCTCTGCAGCTTCTTCTGGG + Intronic
1048593276 8:135841376-135841398 CTCTATGTGTCTCTTCTTCTAGG + Intergenic
1049228286 8:141468112-141468134 CCCTCTGTCCATCTCCTCCTAGG + Intergenic
1049854199 8:144851381-144851403 CACTCTAGGCATCTGCATCTGGG - Exonic
1051380680 9:16455412-16455434 CACTCTGTGTATTTTCTTTTTGG - Intronic
1052505903 9:29354147-29354169 CACACTGTATATATTCTTCTAGG + Intergenic
1052680780 9:31689478-31689500 CACTCTGTTCACCTCATTCTGGG - Intergenic
1055237329 9:74139457-74139479 ATCTCTGTGCATCTTCATCAAGG + Intergenic
1057379117 9:94553354-94553376 CACTCCCTGCATCCTGTTCTAGG - Intergenic
1057879964 9:98785790-98785812 CACTCTGTGCTCCTTGTCCTGGG - Intronic
1058251830 9:102707587-102707609 CATTGTGTGCATTTTCATCTTGG - Intergenic
1059532781 9:115052171-115052193 CACTCTGTACAATGTCTTCTGGG - Intronic
1060092905 9:120760308-120760330 CTTTCTGTGCCTCTTCCTCTGGG - Exonic
1061333288 9:129911356-129911378 CTGTCTGTGCAGATTCTTCTTGG - Intronic
1061812277 9:133169251-133169273 CTGTCTGTGCAGATTCTTCTTGG + Intergenic
1187862039 X:23692074-23692096 CCCTATGTGCCTCTTCATCTGGG - Intergenic
1188244996 X:27828937-27828959 CACTCTGTGCCACTACTTATTGG - Intergenic
1188488320 X:30707351-30707373 CACTAAGTACATTTTCTTCTAGG + Intronic
1189174932 X:38946855-38946877 CCTTCTTTGCTTCTTCTTCTTGG + Intergenic
1189241089 X:39525213-39525235 CACTCTATGCTTCCTTTTCTAGG - Intergenic
1190808817 X:53864251-53864273 TACTGTGTGCACCTTCTTATGGG - Intergenic
1191782785 X:64886411-64886433 CAGTCTCTGGATCTTTTTCTGGG + Intergenic
1193635643 X:83946191-83946213 CACTCTGTGCCTTTTATTTTGGG + Intergenic
1193894707 X:87098807-87098829 CCCTCTGTGCATGTTCATATTGG + Intergenic
1195247314 X:103006059-103006081 CACTCTGGGCCTCCACTTCTCGG + Intergenic
1195500459 X:105592386-105592408 CACTCTGTGCCTTTTGTTGTGGG + Intronic
1196104457 X:111881522-111881544 TGGTCTGTGCAACTTCTTCTAGG - Intronic
1196145838 X:112315877-112315899 TACTCTCTGCATCTTTGTCTAGG - Intergenic
1196698588 X:118641137-118641159 CATTATGTGCATCTTCGTGTTGG + Intronic
1196787022 X:119429716-119429738 CACCCTGTGCTTCTCCTTCATGG - Intronic
1198064608 X:133084146-133084168 CACTCTCATCAGCTTCTTCTAGG + Intronic
1198137308 X:133766788-133766810 CATTATGTCCATCTTCTTCAAGG + Intronic
1199085217 X:143620442-143620464 CACTCTCTGCTCATTCTTCTTGG - Intergenic
1199270050 X:145872702-145872724 CCCTCTGTGCACGTTCATCTGGG + Intergenic
1199540821 X:148956120-148956142 CCCTCTGTACTTCTTCTTCTCGG - Exonic
1199669844 X:150135239-150135261 GAATTTGTGCATCTTCTTGTAGG - Intergenic
1201349478 Y:13023809-13023831 CACTGTGTACATATTCTTATGGG + Intergenic