ID: 1131304443

View in Genome Browser
Species Human (GRCh38)
Location 15:91229170-91229192
Sequence CTTCCAACAGAAAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131304439_1131304443 6 Left 1131304439 15:91229141-91229163 CCTCATAGATTACTTGGAACACC 0: 1
1: 0
2: 1
3: 22
4: 140
Right 1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG 0: 1
1: 0
2: 1
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131304443 Original CRISPR CTTCCAACAGAAAGGGAACA TGG Intronic
900827371 1:4937580-4937602 CTAAGGACAGAAAGGGAACAAGG + Intergenic
901140219 1:7024254-7024276 CTTCCTACTGAAAATGAACATGG + Intronic
901147181 1:7073148-7073170 TTTCCAAAGGAAAGGGGACAAGG + Intronic
901450492 1:9333738-9333760 ATTCCAACGGAAAGGAAACGAGG + Intronic
902209251 1:14892855-14892877 CTTCCAGAAGAAAGGAAAAAAGG + Intronic
903552230 1:24165896-24165918 CTACCAAAAGAAAGTGACCACGG + Intronic
910471860 1:87562131-87562153 TGTTCAACAGAAAGGGAAGAAGG - Intergenic
910568623 1:88675516-88675538 CTTCCTACAGAACAGGGACAGGG - Intergenic
911790418 1:102008660-102008682 CTTCCATCAGCAAGGCACCAAGG - Intergenic
914738435 1:150441345-150441367 TCTCCAACAGTAAGGGCACAGGG - Intronic
914823271 1:151121778-151121800 TTTCCCAAAGAAAGGGAATATGG + Exonic
915721358 1:157988152-157988174 CCTCCTACAGAAGGGGAAGATGG - Intergenic
916377818 1:164174972-164174994 CTTCCAACAGGAAGAAAAAATGG - Intergenic
916586695 1:166155641-166155663 CTTCCTAAAGAAAGTGAAGATGG + Intronic
916918107 1:169431923-169431945 CTTCCAAAAGGAAGAAAACAAGG - Intronic
917206419 1:172576715-172576737 CTCCCACCATAAAAGGAACAAGG - Intronic
917606452 1:176635647-176635669 TTTCCAAGCCAAAGGGAACAAGG - Intronic
917687123 1:177428301-177428323 CTTCCAATATCAAGGTAACAGGG - Intergenic
917948608 1:180004387-180004409 CATGCAAAAGAAAGGCAACAGGG - Intronic
918168179 1:181970476-181970498 CTGCACCCAGAAAGGGAACAAGG - Intergenic
918469525 1:184857144-184857166 CTTCCAACAGATAGAGTGCAAGG + Intronic
918617014 1:186556473-186556495 CTTCCAACAAACAAGAAACAAGG - Intergenic
919797938 1:201332456-201332478 TTTCCTAGAGAAAGAGAACAAGG + Exonic
920343017 1:205287453-205287475 CTTCCACCTAAGAGGGAACAGGG - Intergenic
921768304 1:219000882-219000904 TTTCCAGTAAAAAGGGAACAAGG - Intergenic
922621654 1:226993239-226993261 CTTCCATCTGAAAGGTTACAAGG - Exonic
923030644 1:230246727-230246749 ATTCCAACGGAAGGGGACCAGGG - Intronic
924281242 1:242439361-242439383 CATCCAGCAGAATGGGAAAAAGG + Intronic
924614646 1:245602708-245602730 CTTCCAAAAGAGAGGCAACCAGG + Exonic
924906363 1:248456921-248456943 CATCCAACAGCAAATGAACATGG - Intergenic
924921527 1:248635116-248635138 CATCCAACAGCAAATGAACATGG + Intergenic
1064372371 10:14763730-14763752 CTTGAGACAGTAAGGGAACAAGG - Intronic
1064906704 10:20355015-20355037 TTTCCAAGAGAAAGGGGAAAAGG - Intergenic
1065169857 10:23016065-23016087 ATTCCAAAAGGATGGGAACAAGG - Intronic
1065766732 10:29037257-29037279 CTTCAAACAGAAAGGGATTTGGG + Intergenic
1066067887 10:31775473-31775495 CTTCCAACACTATGGAAACAAGG + Intergenic
1067246223 10:44548506-44548528 CTCACAACAGAAAGGAAACAAGG - Intergenic
1067294545 10:44967780-44967802 CTCCCAAGAGAACGGGAACATGG - Intronic
1068321693 10:55426627-55426649 CTTCCAACAGCGAGGGCAAAGGG + Intronic
1068396538 10:56469141-56469163 GTTCAGACAGAAAGAGAACATGG - Intergenic
1068400678 10:56523871-56523893 CTTCTAACAGAAGGAGAAAATGG - Intergenic
1068581340 10:58743394-58743416 CATCCAACAAAATGGGACCAGGG + Intronic
1069378720 10:67820461-67820483 CTTTGAACAGGAAGGGAAAAGGG + Intronic
1069931190 10:71882814-71882836 CTCCCAAGAGAAAGAAAACAGGG - Intergenic
1074573876 10:114650165-114650187 CTGCTAACAGAAAGGGAATATGG - Intronic
1074765172 10:116695008-116695030 ATTCCACCAGTAAGGGGACAAGG - Intronic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1079283666 11:19109710-19109732 CTTCCCACAGAAAGGGTAACTGG + Intergenic
1080042894 11:27777640-27777662 CTTGCAACAAAAAGGCAACTTGG - Intergenic
1081737250 11:45412655-45412677 CTTCCAGCAGAAAGGTAGCTGGG + Intergenic
1081737538 11:45414368-45414390 CTTCCAAGAGAAGGAGATCATGG + Intergenic
1082645516 11:55719934-55719956 CTTCCACCAGTAAGGGCAAAGGG + Intergenic
1084861447 11:72021195-72021217 CTTCCTACAGAAAGGTAAGTAGG - Exonic
1085311531 11:75519843-75519865 CATCCAACCGAAATGTAACATGG - Intronic
1086163437 11:83749232-83749254 CTTCAAAAAGAAAGGCAAAAAGG - Intronic
1088560620 11:111112161-111112183 GTCCCAAGACAAAGGGAACATGG + Intergenic
1090935268 11:131335920-131335942 CTACCAAAAGAAAGGGAATTTGG + Intergenic
1091602973 12:1929176-1929198 CTTCCAACACAGTGGCAACAAGG + Intergenic
1094614921 12:32027828-32027850 CAGCCAACAGAAAGAGACCATGG + Intergenic
1099339125 12:81405071-81405093 TTTCCAACAGAAGAGGAAGAAGG - Intronic
1099610251 12:84858358-84858380 CTTCAAACAGAAAGGAGACTAGG - Intergenic
1100702760 12:97165368-97165390 CTTCCAACAAAAGGGAAAAATGG - Intergenic
1100887895 12:99092620-99092642 CTCCGAACAGGCAGGGAACATGG + Intronic
1101110654 12:101482498-101482520 GTACCATCAGAAAGGGAAGATGG - Intronic
1101729733 12:107416967-107416989 TTCTCAACAGAAAGGGAAGAAGG - Intronic
1105685832 13:22780784-22780806 TTTCAAATAGAAAGGGGACAGGG + Intergenic
1105885147 13:24635627-24635649 CTTCCCACAGAATGGGTATATGG + Intergenic
1107020388 13:35745106-35745128 GTGGCAAGAGAAAGGGAACAGGG + Intergenic
1109303913 13:60618213-60618235 ATTCCAAGAGAAAGAGGACAAGG - Intergenic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1110437805 13:75494915-75494937 CTTCCATCAGAAAGTCAAAAAGG + Intergenic
1110495122 13:76159366-76159388 CCTGCAATAGAAAGGGAAAAAGG - Intergenic
1112895842 13:104298882-104298904 CTTCCAACACCCAGGAAACATGG + Intergenic
1112917946 13:104574109-104574131 CTGGCAGTAGAAAGGGAACAGGG + Intergenic
1113007192 13:105720279-105720301 CTTCCAGCAGGAAGTGAACTAGG - Intergenic
1116194354 14:41703619-41703641 CTCCCAAAAGAAAGAAAACAAGG - Intronic
1116457627 14:45137081-45137103 CTTCCACCAGGAAGGAAATATGG + Exonic
1120028295 14:79610860-79610882 CTTGCAGCATAAAGGGTACATGG - Intronic
1120711432 14:87797415-87797437 CCTGCAACAGCAAGAGAACAAGG + Intergenic
1122988725 14:105226284-105226306 GTTCAAGCTGAAAGGGAACAGGG + Exonic
1123149729 14:106169429-106169451 TTTCAAAGAGAAAGGGAAGATGG + Intergenic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1131369238 15:91866036-91866058 CTTCTTACAGAAAGGAAACAGGG - Intronic
1131526165 15:93154413-93154435 CTTCCAAAACAGAGGGCACAAGG - Intergenic
1131686648 15:94775019-94775041 CTACCATCAGGAAGTGAACAGGG + Intergenic
1131949458 15:97665539-97665561 CTTACAGCAGAAGAGGAACAAGG - Intergenic
1133503704 16:6389923-6389945 TTTCCAGCAGAAATGCAACAGGG + Intronic
1134032962 16:11007311-11007333 CTTCCAAAAGAAAAAGAAAAAGG - Intronic
1134506749 16:14813889-14813911 GGTCAAACAGAAAGGGAAAAAGG - Intronic
1134573809 16:15314932-15314954 GGTCAAACAGAAAGGGAAAAAGG + Intergenic
1134728611 16:16441386-16441408 GGTCAAACAGAAAGGGAAAAAGG - Intergenic
1135876943 16:26210721-26210743 CTTCCAACAGACAGATAAGAAGG - Intergenic
1136502083 16:30676667-30676689 CTTCCAACGGAAAGAAAGCAGGG + Intergenic
1136547438 16:30963688-30963710 CTTTCAAAAGACAGGGAACTAGG + Intronic
1137411779 16:48234737-48234759 CTGCCAACAGAAGTGGGACAGGG + Intronic
1137576119 16:49601465-49601487 CTTCCCACAGGAACGGAACCTGG + Intronic
1138245896 16:55467113-55467135 TTTCCAGAGGAAAGGGAACATGG - Intronic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138579072 16:57927777-57927799 CTGCCCATATAAAGGGAACAGGG + Intronic
1140605413 16:76530868-76530890 TTTCCACCAGGAAGCGAACAGGG + Intronic
1141749381 16:85948100-85948122 CTTCCAACGGCAACGAAACATGG - Intergenic
1144229161 17:13182548-13182570 GTTCTAACAGGAAGGGAAAAGGG - Intergenic
1148962385 17:51404128-51404150 AGTCCAACAGAAGGGGAACTGGG + Intergenic
1151969176 17:77449138-77449160 CCTCCAGCAGAAACGGCACATGG - Intronic
1155396970 18:25396583-25396605 CTTGCCACAGACAGGGAACATGG + Intergenic
1155403915 18:25467186-25467208 CTTCCAACAGAAAAGGAATGGGG + Intergenic
1156604938 18:38655172-38655194 CTCCCACCAGAAATGGAACTTGG + Intergenic
1158315046 18:56202968-56202990 CTTCCAAAAGAAATAGAACATGG - Intergenic
1159943082 18:74424157-74424179 CTCCCAAGAGAAAGGGGACATGG - Intergenic
1162283334 19:9717958-9717980 CTCCCAACAGAGAAGAAACAGGG + Intergenic
1163813320 19:19448143-19448165 CTTCCCACAGAAGGGGAGCATGG + Intronic
1164949885 19:32328294-32328316 CCTCCAAGAGAAGGTGAACATGG + Intergenic
1166360855 19:42252493-42252515 CATGCAACACAAAGGGAACTCGG + Intronic
1167817176 19:51893551-51893573 GTTCCAACAGAAAGAGAAACAGG + Intronic
1168404307 19:56102923-56102945 CATCCAGCAGAAAGGAAACTTGG + Intronic
926233264 2:11020747-11020769 TCTCCATCACAAAGGGAACATGG + Intergenic
926266536 2:11327544-11327566 CTTCAATGAGAAAGAGAACATGG + Intronic
929135122 2:38616512-38616534 CATCCAACAGATTTGGAACAAGG + Intergenic
929938178 2:46310189-46310211 TTACCATCAGAAAGAGAACATGG - Intronic
930413412 2:51056480-51056502 CTTCCAACTAAAAGGAAACAGGG - Intergenic
930758945 2:55010439-55010461 CTACCAAAAGAAAGGAAATAAGG + Intronic
931228530 2:60354317-60354339 GTGCCAACAGAAAGAGAATAGGG - Intergenic
931734061 2:65177995-65178017 CTTCCAACAAAAACGGGGCAGGG + Intergenic
932085198 2:68751517-68751539 TTTGGAACAGAAAGGGAAAATGG - Intronic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
937252217 2:120532181-120532203 CTTCCTGCAGAAAGTGAACTTGG + Intergenic
939234774 2:139477203-139477225 CTTCCTAAAGGAAGGGAAAAAGG + Intergenic
940105961 2:150100554-150100576 TTTCCCACAGCAAGTGAACAAGG + Intergenic
940173116 2:150849893-150849915 CCTCCATCAGCAAGGGAAAAGGG + Intergenic
941417116 2:165234440-165234462 CTTCCTACAGATGGGCAACAGGG + Intergenic
943797941 2:192021733-192021755 CTTCAAACTGAAAAGGAGCAGGG + Intronic
943853353 2:192756465-192756487 CTTCCACCAGAAAGGGAATAAGG - Intergenic
945405365 2:209441253-209441275 TTTGCAATAGAAAGGCAACAAGG + Intronic
946352229 2:219162641-219162663 CTTTCTAGAGAAAGGGAACCTGG - Intronic
946763660 2:223020369-223020391 TTTCCAAAAGGAAAGGAACAGGG + Intergenic
948214286 2:236217000-236217022 CTTCCAAGAGGAAGGAAAGATGG - Intronic
948329854 2:237156348-237156370 CTGCCCACAGACAGGGAACCGGG + Intergenic
949003628 2:241632871-241632893 CTCCTAACGGGAAGGGAACATGG + Intronic
1168895447 20:1320534-1320556 ATTCAAACAGAAAGGCAGCAGGG + Intronic
1169256046 20:4099862-4099884 TTTCTAACACAAAGGGAAGAAGG - Intergenic
1170499120 20:16956656-16956678 CTTCCAACAGTGAGGAAGCAAGG + Intergenic
1171879026 20:30603029-30603051 CTTCATCCAGAAAGGGGACAAGG + Intergenic
1172631466 20:36381260-36381282 CTCACAACAGATAGGGAAGATGG + Intronic
1173280756 20:41625387-41625409 CTTCCCACAGAGAGAGAACAAGG - Intergenic
1174494371 20:50930016-50930038 TTTCCAGCAGACAGGGATCAAGG + Intronic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1179124443 21:38578581-38578603 TTTCCACCAGCATGGGAACATGG + Intronic
1181399133 22:22640624-22640646 CTTTCAGCAGAAAGGGATTAAGG - Intergenic
1181577857 22:23807148-23807170 CTTCACCCAGAAGGGGAACAAGG + Intronic
1181650290 22:24255435-24255457 CTTTCAGCAGAAAGGGAGTAAGG + Intergenic
1182754752 22:32669840-32669862 CATCCAACAGAAAGAAAAAAAGG - Intronic
1183236369 22:36621664-36621686 CATGCAACAGAAAGGCAAGAGGG - Intronic
1184077659 22:42193146-42193168 ATTTCAACAGAAAAGGAAAAAGG + Intronic
949578941 3:5366933-5366955 CTTCCATCAGAAAGAGGAAATGG - Intergenic
950412994 3:12851085-12851107 ATCCCTACAGAAAGGGGACAAGG - Intronic
950451011 3:13065739-13065761 CACCCAACAGAAATGGAACCAGG + Intronic
951621718 3:24609091-24609113 CTTCCAAAAGATATGGAAAATGG + Intergenic
951947262 3:28153772-28153794 CTTCCCATTGAAAGGAAACAGGG + Intergenic
952247341 3:31608431-31608453 GTTCAAACACAAAGGGAAGATGG + Intronic
953549112 3:43886740-43886762 CCTCCCACAGAAAGGGCAGAAGG + Intergenic
954229908 3:49208817-49208839 CTACCAACAGAGAGGGTACATGG + Intronic
955159462 3:56449418-56449440 CGCCCAAGAGTAAGGGAACACGG + Intronic
955342714 3:58137731-58137753 CTTCCTAAAGAAAGGAAACATGG - Intronic
956184226 3:66547145-66547167 ATCCCAAGAGAAAGGGAACAAGG - Intergenic
956539787 3:70323736-70323758 ATGCCAGCAGAAAAGGAACAAGG - Intergenic
960109189 3:113828660-113828682 CTTCAATGAAAAAGGGAACATGG - Intronic
960524171 3:118690829-118690851 CTACCTACAGAGAGGTAACATGG + Intergenic
961022796 3:123523282-123523304 CTTCCTTCAGAGAGAGAACACGG - Intronic
961805151 3:129483907-129483929 ATCCCTACAGAAAGGGGACAAGG - Intronic
962636468 3:137337247-137337269 CTTCTAGCAGAAAGGGGACACGG - Intergenic
963101708 3:141613094-141613116 CTTCAAAAAGAAAGTAAACAGGG + Exonic
965531880 3:169778752-169778774 ATTCCAACTGCAAGGAAACAAGG - Exonic
965564213 3:170094439-170094461 TGACAAACAGAAAGGGAACATGG - Exonic
967558968 3:190895896-190895918 CTTCCAACACAATGGGCAAAAGG + Intergenic
967682309 3:192378541-192378563 TTTCCAAAAGTAACGGAACAGGG + Intronic
969195727 4:5562399-5562421 CTTCCTACATAAAGCAAACATGG + Intronic
970702435 4:18758057-18758079 CTTCCAACTGCAAAGGAACTTGG + Intergenic
973131102 4:46649335-46649357 CTACGAACAGCAAGGGAAAATGG + Intergenic
973590901 4:52440603-52440625 CTTCCAACAGAAGGGGCACTTGG + Intergenic
976263963 4:83172986-83173008 CTTCCAAAAGACAGGGGACTTGG - Intergenic
977018668 4:91730608-91730630 CCTCCTACACAAAGGGAGCATGG - Intergenic
978108040 4:104928659-104928681 TTTCCCACAGGAAAGGAACATGG + Intergenic
978284612 4:107061521-107061543 CTTGAGACAGAAAGGGAAAACGG - Intronic
979492593 4:121345313-121345335 CCTACAACAGAAAGCGACCAAGG - Intronic
983137055 4:164097831-164097853 CTTCCAAATAAAAGGGAATATGG - Intronic
983569801 4:169193394-169193416 CTTCCAACAGACAATGCACAAGG + Intronic
985487356 5:158902-158924 CTTCCCAGAGAAAGGGATCTTGG + Intronic
986957302 5:13168711-13168733 CTTGCCACAGAAAGGACACAAGG + Intergenic
989036413 5:37177056-37177078 CTTAGATCAGAAAGGCAACATGG - Intronic
989588395 5:43091134-43091156 CTTCCATCTGTAAGGGCACATGG - Intronic
990996202 5:61734542-61734564 CTTCCAACTGGAAAGGCACAGGG - Intronic
993998088 5:94746192-94746214 CTTCCATTAGCAAGGGAAAATGG + Intronic
996039455 5:118793836-118793858 CTCCCAACTGAAACGGACCACGG + Intergenic
997286063 5:132679463-132679485 CCTCCAAGAGAAAGGAAACTGGG + Intronic
998191871 5:140032109-140032131 CTTACTACAGAAAAGGAACCTGG + Intronic
999150549 5:149423531-149423553 TTTCCAGCTGAAAGGGAGCAAGG - Intergenic
999166735 5:149555724-149555746 CTACCAAAAGAAAGAGAAAAAGG + Intronic
999505082 5:152186191-152186213 CTCCCAGCAGCAATGGAACAGGG - Intergenic
999913892 5:156236780-156236802 CTCCCAACACCAAAGGAACAAGG + Intronic
1000866260 5:166518523-166518545 CTTCCACCAGCAAGGGCAAAGGG + Intergenic
1002384522 5:178856318-178856340 ATGCCAACAGAAATGGAAGAAGG - Intergenic
1003114174 6:3272493-3272515 TTACAAACAGAAAGGGAAAAAGG + Exonic
1003303619 6:4907214-4907236 CCTCCTACAGAAAGGGGAGATGG + Intronic
1004519875 6:16351745-16351767 ATTCCAACAGAAGGGAAACCAGG + Intronic
1005990456 6:30898813-30898835 CTTCCAATAGGAAGGGAGGAGGG + Intronic
1007088775 6:39168913-39168935 CTTGCAACAGAAAGTGACTAGGG - Intergenic
1008095679 6:47337067-47337089 CTTATAACAGAAAGGGGACAGGG + Intergenic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1009026376 6:58005257-58005279 TGTCCAGCAGAAAGGGAAAAAGG + Intergenic
1009201926 6:60756730-60756752 TGTCCAGCAGAAAGGGAAAAAGG + Intergenic
1009564862 6:65300838-65300860 CTCCCAAAACAAAGGTAACAAGG - Intronic
1010756862 6:79675557-79675579 CACTCAAGAGAAAGGGAACAAGG - Intronic
1011034770 6:82961186-82961208 TTTGCAAGAGAAAGGGAAAATGG + Intronic
1011493213 6:87913697-87913719 CTGCCATCAGAAAGGGAGAAAGG - Intergenic
1011493629 6:87917297-87917319 GTTTCAACAGAAAGGAAAGAAGG - Intergenic
1012148289 6:95713987-95714009 ATTCCTTCAGAAAGGGAAAAAGG - Intergenic
1012244014 6:96906100-96906122 CATCCAACAGAAATGAAACTCGG - Intergenic
1014910136 6:127082272-127082294 AGTCCAAAAGATAGGGAACAAGG + Intergenic
1015189191 6:130454892-130454914 CTTCCAACATAAAGGGAGTGAGG + Intergenic
1015643985 6:135366322-135366344 ATTCCAAAAGATAGAGAACAAGG - Intronic
1015961279 6:138651592-138651614 TTTCCAAGAGGAAGGGAATAAGG + Intronic
1015980034 6:138829257-138829279 TTTCCCACCGAAAGGAAACAGGG - Intronic
1016084356 6:139894655-139894677 CTTCCACCAGCAAGGGCAAAGGG + Intergenic
1016628018 6:146195529-146195551 CCTCCAACAGTAAGTGCACAGGG + Intronic
1016828277 6:148407983-148408005 CTACCAGCAGGGAGGGAACAGGG + Intronic
1021358143 7:19679520-19679542 TTTCCAACAGAAATATAACATGG + Intergenic
1021772033 7:24013868-24013890 CTTCCAAAAAAAATGGAAGAGGG + Intergenic
1021804330 7:24340211-24340233 ATTCCAACAGAAAGAAATCAAGG + Intergenic
1022508355 7:30920734-30920756 CTTGGGACAGAAAGGGAACTGGG + Intronic
1022719326 7:32928688-32928710 CTTCCTAAACAAAGGGAACAAGG + Intergenic
1023670641 7:42572565-42572587 CTTAGAATAGAAAGGGAACAAGG - Intergenic
1024208550 7:47184265-47184287 CTTCCAACTGGAAGGTAACGTGG + Intergenic
1024232743 7:47375085-47375107 CTTCCATCTCAAAGGGAGCATGG + Intronic
1024378608 7:48668039-48668061 CTTCCTACTGAAAGAGGACAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027237596 7:76307354-76307376 CTGCCCACAGAAAGGCGACAGGG + Intergenic
1028046821 7:86130705-86130727 CTTCCACCAGCGAGGGCACAGGG + Intergenic
1028795264 7:94895209-94895231 CTTCCAACAGAGATGGACCCAGG - Intergenic
1030001439 7:105068196-105068218 CTTCTTACAGAAATAGAACAGGG - Intronic
1031203258 7:118718886-118718908 CTTCCAAAAGAACCAGAACAGGG + Intergenic
1032309403 7:130769348-130769370 CTTTAAACAGAAAAGTAACATGG + Intergenic
1032716492 7:134513286-134513308 CTTTCTAGAGAAAGGCAACAAGG - Intergenic
1035175521 7:157047248-157047270 CATCTAACAGAAAGGCAGCAGGG - Intergenic
1035200919 7:157265305-157265327 CTTCCAACAGGAAGACAATAAGG - Intronic
1036103265 8:5811135-5811157 CATCCAAGAGAAAAGGAATATGG - Intergenic
1037285869 8:17299796-17299818 CTTCCAAAAACAAGGGAACAAGG - Exonic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1039161000 8:34619803-34619825 CTTCCAACAGAGAGAAATCAAGG - Intergenic
1039394101 8:37208336-37208358 GTGCCAACATGAAGGGAACATGG + Intergenic
1039662962 8:39487173-39487195 ATTCCAACAGACAGGCAAAATGG + Intergenic
1040860114 8:51990415-51990437 CTACCAAGAGAAAGGAAAGATGG + Intergenic
1041269120 8:56093680-56093702 CTTCCAGCAGAAAGAGCAGATGG - Intergenic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1042167586 8:65960588-65960610 CTTCCAAGAGAAAGAGCAGAAGG - Intergenic
1042339616 8:67665388-67665410 ACTCCAACAGAATGGGAAAATGG + Intronic
1042544402 8:69938112-69938134 CTTCCAACAGAAATGGGCAAAGG - Intergenic
1044965517 8:97570243-97570265 CTTCCAATAGAAAGAGATAAAGG - Intergenic
1045701234 8:104868867-104868889 CTTACAAAGGAAAGGAAACAAGG + Intronic
1045792186 8:105996379-105996401 CTGGCAACAAGAAGGGAACATGG + Intergenic
1045921567 8:107536070-107536092 GTTCCTATAGAAAGGCAACATGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1047614223 8:126549874-126549896 CTTCTAAGAGGAAGGGAAGATGG + Intergenic
1047796863 8:128266416-128266438 GTTCCACCAGAGAGGGAAGACGG + Intergenic
1048410648 8:134168892-134168914 CTCTCAGCAGAAAGGGGACATGG + Intergenic
1050917270 9:11152923-11152945 CTTCCAAAAAAAATGGAAAAAGG + Intergenic
1052183618 9:25562809-25562831 CTTCCAGCGGAAGGGGAAGAGGG + Intergenic
1052216454 9:25972271-25972293 CTTCCACCAGCAAGGGCAAAGGG - Intergenic
1056652159 9:88475086-88475108 CCTCCAGCAGAAAGGGAACCAGG + Exonic
1060206886 9:121687354-121687376 CCACCAAGAGAAAGGGCACAGGG + Intronic
1186024637 X:5295952-5295974 TTTCCTACAGAGAGGAAACATGG + Intergenic
1186365370 X:8887110-8887132 CTGCCAAAAGAAAGAGGACAAGG - Intergenic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1189539429 X:41970934-41970956 CTTGGAAAAGAAAGGGAAAATGG + Intergenic
1190579728 X:51880721-51880743 GTACCAACATAAAGAGAACAGGG + Intronic
1191141403 X:57120022-57120044 CCTCCAACAGAGAGGGAGCCAGG - Exonic
1191143048 X:57135990-57136012 CCTCCAACAGAGAGGGAGCCAGG - Exonic
1194711188 X:97238209-97238231 CTTCTAACAAAAAGAAAACAAGG - Intronic
1195512518 X:105733893-105733915 CTTTCAACAAAAAAGTAACAAGG - Intronic
1198282376 X:135154678-135154700 TCTCCAACACCAAGGGAACAGGG + Intergenic
1198284661 X:135177650-135177672 TCTCCAACACCAAGGGAACAGGG + Intergenic
1198288583 X:135217844-135217866 TCTCCAACACCAAGGGAACAGGG - Intergenic