ID: 1131304983

View in Genome Browser
Species Human (GRCh38)
Location 15:91234424-91234446
Sequence TGGTGGCACTCAGTCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 2, 1: 2, 2: 12, 3: 64, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131304972_1131304983 23 Left 1131304972 15:91234378-91234400 CCTAAATGCAGTGGGAATAATTG 0: 3
1: 2
2: 24
3: 42
4: 252
Right 1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG 0: 2
1: 2
2: 12
3: 64
4: 199
1131304978_1131304983 -3 Left 1131304978 15:91234404-91234426 CCCAGGGTGCAAGGGCCAAGTGG 0: 1
1: 0
2: 4
3: 102
4: 298
Right 1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG 0: 2
1: 2
2: 12
3: 64
4: 199
1131304980_1131304983 -4 Left 1131304980 15:91234405-91234427 CCAGGGTGCAAGGGCCAAGTGGT 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG 0: 2
1: 2
2: 12
3: 64
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131304983 Original CRISPR TGGTGGCACTCAGTCACCAA AGG Intronic
903123975 1:21235482-21235504 TGGTGGCCCTCAGACATCAGGGG - Intronic
903330496 1:22594671-22594693 TGGAGGCACTCAGACGCCCAGGG - Intronic
905920725 1:41716903-41716925 TGCTGGCACTCAGACAGCCAGGG - Intronic
906879452 1:49574708-49574730 TGGTGGTACTCAACCATCAAAGG + Intronic
907564803 1:55424874-55424896 TGGGGGCACCCAGTAACAAAAGG + Intergenic
908616476 1:65928481-65928503 TGGTGGCACTCAACCTTCAAAGG - Intronic
909032860 1:70562050-70562072 TGGTGGCACTCAACCATTAAAGG + Intergenic
909810771 1:79929796-79929818 TGGTGGCACTCAACCATCAAAGG + Intergenic
910542749 1:88379408-88379430 TGGTGGCACTTAATAACCAAAGG - Intergenic
910587975 1:88899970-88899992 TGGTGGCACTCAACCGTCAAAGG + Intergenic
911109344 1:94165963-94165985 TGGTGACACTCAACCATCAAAGG - Intronic
911321665 1:96421018-96421040 TGGTGACATTTATTCACCAAAGG + Intergenic
911735993 1:101337189-101337211 TGGTGGCACTCAACTACCGAAGG + Intergenic
911980230 1:104557899-104557921 TGGTGGCACTCAGCCGTCAAAGG + Intergenic
912173249 1:107126475-107126497 TCAGGGCAGTCAGTCACCAAAGG + Intergenic
913192383 1:116424645-116424667 TGTTGTCACCCAGTCACAAAGGG + Intergenic
915135344 1:153727940-153727962 CGGTGGCGCTGAGTCTCCAAGGG - Intergenic
915988256 1:160488062-160488084 GAGTGTCACTCTGTCACCAAGGG - Intronic
916380730 1:164207888-164207910 TGGTGTCACACAATCACTAAAGG + Intergenic
916579895 1:166097543-166097565 TGGTTGGTCTCAGTCCCCAAAGG - Intronic
919098358 1:193063598-193063620 TGTTGGAACGCAGACACCAAAGG - Intronic
919230247 1:194764319-194764341 TGGTGGAACTCAACCATCAAAGG - Intergenic
920197189 1:204236598-204236620 TGGTGGCACTCAACCATCAAAGG + Intronic
924182681 1:241455004-241455026 TAGTGGCACTTAACCACCAAAGG - Intergenic
1063094577 10:2898521-2898543 TGGGGGCACTCACTCATGAATGG - Intergenic
1064517888 10:16169999-16170021 TGGCGGCACTCAACCATCAAAGG - Intergenic
1066167270 10:32801018-32801040 CGGTGGCACTCAACCATCAAAGG - Intronic
1067332917 10:45338450-45338472 TGGTGGCACTCAACCATCAAAGG + Intergenic
1067754581 10:48995483-48995505 TGGCGGCACTCAATCATCAAAGG - Intergenic
1068225583 10:54103366-54103388 TGGTGGCGCTCAACCATCAAAGG - Intronic
1069140038 10:64811093-64811115 TGGTGGAACTCAACCACCAAAGG - Intergenic
1071484105 10:86086479-86086501 TGGTGGCACTCAGTCTCCCTGGG - Intronic
1071943016 10:90609544-90609566 TGGTGGCACTTAATCATCAAAGG - Intergenic
1073557104 10:104464140-104464162 TGGCGGCACTCAACCATCAAAGG + Intergenic
1073854863 10:107662455-107662477 TGGGGGCACTCAACCATCAAAGG + Intergenic
1074704738 10:116120784-116120806 TGTTGTCACTCAGCCACCCAAGG + Intronic
1074707429 10:116147346-116147368 TGGCAGCTGTCAGTCACCAAAGG + Intronic
1075851450 10:125591389-125591411 TGGTGGCTCCCAGTTACTAAGGG - Intronic
1075985352 10:126780264-126780286 GGGTGGCACTCATTCATCAGTGG - Intergenic
1077238514 11:1497524-1497546 TGGTGGAACACAGCCACCAGCGG + Intronic
1077400917 11:2356772-2356794 TGGGGGCATTCAAGCACCAAAGG + Intergenic
1081072562 11:38629330-38629352 TAGTGGCACTCAATCATCCAAGG + Intergenic
1081359925 11:42162948-42162970 GGGTTTCACTCTGTCACCAAGGG - Intergenic
1081891408 11:46545433-46545455 GGGTGTCACTCTGTCACCCAGGG - Intronic
1082999387 11:59277759-59277781 TGGTGGCACTCAACCATCAAAGG + Intergenic
1083092906 11:60219325-60219347 TGGCAGCACTCAGCCATCAAAGG + Intronic
1087373824 11:97318978-97319000 TGGCAGCACTCAACCACCAAAGG + Intergenic
1088408501 11:109507368-109507390 TGGTGCCACCCAGTCACCAAAGG + Intergenic
1093036064 12:14333558-14333580 TGGCGGCACTCAACCATCAAAGG + Intergenic
1095856457 12:46865448-46865470 TGGTGACACTCAATCATCAAAGG - Intergenic
1096296748 12:50390621-50390643 TAGTGGCACCCAACCACCAAAGG - Intronic
1097985913 12:65783091-65783113 TGGTGGCAGTCAGAGACCACTGG + Intergenic
1098715865 12:73828033-73828055 TGGTCACACTCAGTGATCAAAGG + Intergenic
1098806968 12:75032933-75032955 TGGTGGCACTCAGTCATCAATGG + Intergenic
1099184027 12:79498454-79498476 TGGTGGCACTCAATTGTCAAAGG - Intergenic
1100083084 12:90876450-90876472 TGGTGGCACTCAACCATCAAAGG + Intergenic
1101275643 12:103198191-103198213 TGCTGGCACTCATTCACCCACGG - Intergenic
1101542847 12:105680882-105680904 TGGTGGCACACAACCATCAAAGG + Intergenic
1103560422 12:121790566-121790588 TGGTGGCACTCACTGACCAGGGG + Intronic
1103887846 12:124216222-124216244 GGGTGGAACTCTGTCCCCAAAGG - Intronic
1106264316 13:28096461-28096483 GAGTCGCACTCTGTCACCAAGGG + Intronic
1107805839 13:44153232-44153254 GGGTGGCCCTCAGACACAAAGGG + Intronic
1109292989 13:60498366-60498388 TGGTGGCACTCAACCATCAAAGG + Intronic
1110093398 13:71484186-71484208 GGGTCTCACTCAGTCACCCAGGG + Intronic
1110376949 13:74804706-74804728 TGGGGGCACTGAACCACCAAAGG + Intergenic
1111016415 13:82387601-82387623 TGGTGGCACTCAACCATCAAAGG - Intergenic
1113343881 13:109454457-109454479 TCATGGCACTGAGTCTCCAAGGG + Intergenic
1114675761 14:24439305-24439327 TGGGGCCACTCAGTCAACCAGGG - Exonic
1115059475 14:29172118-29172140 TGGTGGCACTCAACCATCAAAGG + Intergenic
1115868921 14:37778587-37778609 TGCTGGCCCACAGTCATCAATGG - Intronic
1116067851 14:40007385-40007407 TGGTGGCACTCAACTGCCAATGG + Intergenic
1116117901 14:40681074-40681096 TGGAGTCACTCTGTCACCCAGGG + Intergenic
1116531678 14:45979982-45980004 TGGTGGCACTCAACCATCAAAGG - Intergenic
1116538930 14:46073473-46073495 TGGTGGGACTGGGACACCAAGGG + Intergenic
1118247965 14:64130105-64130127 TGCTGGCTCTCAGTGACGAAAGG - Exonic
1120056379 14:79929223-79929245 TGATGGCATTTACTCACCAAAGG - Intergenic
1120556227 14:85932222-85932244 TGGTGGCACTCAACCATCAAAGG - Intergenic
1122327649 14:100891986-100892008 TGGTGGAACTAAGGCAGCAATGG - Intergenic
1129961630 15:79691839-79691861 TGGTGGCACTCAACCATCAAAGG - Intergenic
1131041457 15:89271523-89271545 TGGTCTCACTCTGTCACCTAGGG + Intronic
1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG + Intronic
1131970222 15:97884631-97884653 TGGTCGCACTCAGGCTCCTAGGG + Intergenic
1132593353 16:736375-736397 TGGCGGCACCCAGTCAGCAGAGG - Exonic
1132929759 16:2453055-2453077 TGGTTAAACTCAGTCACCACAGG - Intronic
1133011468 16:2914361-2914383 AGGTGTCTCTCAGACACCAAGGG - Intronic
1133263597 16:4569348-4569370 TGGGGGTACTCAGTTACAAAAGG - Intronic
1134608439 16:15589359-15589381 TGGTGGCACTGAGTAGCCCAAGG - Intronic
1136522029 16:30803115-30803137 GGGTTTCACTCTGTCACCAAGGG + Intergenic
1137252927 16:46753027-46753049 TGATAACACTCATTCACCAATGG - Intronic
1137629059 16:49929480-49929502 TGGTCTCACTCTGTCACCCAGGG + Intergenic
1137636266 16:49989314-49989336 TGGTGGCTGCCAGTGACCAAAGG + Intergenic
1140597648 16:76435420-76435442 TGGTGGCACTCAAACATCAAAGG - Intronic
1140852167 16:78945151-78945173 GGGTGTCACTCTGTCACCCAGGG - Intronic
1141688298 16:85582576-85582598 TGGTGGTCCTCAGTCAGCACTGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1143056279 17:4164425-4164447 AGGTGGCACCAACTCACCAAAGG - Intronic
1144106596 17:11991836-11991858 TGGAGATACTCAATCACCAACGG + Intronic
1147639635 17:41987943-41987965 TGGGCTCCCTCAGTCACCAAAGG - Intronic
1149236240 17:54594026-54594048 TGGTGGCACTCAACCACCAAAGG - Intergenic
1152946519 17:83200629-83200651 TGGTGTCACTCGGTTACCACAGG + Intergenic
1203172885 17_GL000205v2_random:167477-167499 TGGTTGCACTCAGTAGCCAGGGG + Intergenic
1153152912 18:2114980-2115002 TCTTGGCACTTAGTCAACAATGG + Intergenic
1153217941 18:2837391-2837413 TAGTGGCACTCAACCATCAAAGG - Intergenic
1154232280 18:12567999-12568021 TGGTGGCACTCAGTCACCAAAGG - Intronic
1156990522 18:43402483-43402505 TGGTGGCACCCAACCATCAAAGG - Intergenic
1156998362 18:43495935-43495957 TGGTGGCACTCAACCATCAAAGG + Intergenic
1157659858 18:49431460-49431482 TGGTTGTTCTCAGTCACTAAGGG + Intronic
1157748661 18:50159482-50159504 TAGTGACATTCAGTCACCCACGG + Intronic
1158019190 18:52821228-52821250 TGGTGCCACTCAGGTAACAAGGG - Intronic
1159609340 18:70508840-70508862 TGGTGGCACCCATTCAGCACTGG + Intergenic
1160611884 18:80095356-80095378 TGGTGGGACTCGGCCAGCAATGG - Exonic
1164117542 19:22236895-22236917 TGGTGGCACTCAACCATCAAAGG - Intergenic
1164200246 19:23012175-23012197 TGGTGGCACTCGACCATCAAAGG - Intergenic
1165005163 19:32799147-32799169 CAGTGTCACACAGTCACCAAGGG + Intronic
1168168269 19:54569939-54569961 TAGAGGAACTCAGCCACCAAAGG + Intergenic
1168508753 19:56957906-56957928 GGGTGTCACTCTGTCACCCAGGG - Intergenic
1168539593 19:57199151-57199173 TGGTGGCACTCAACCATCAAAGG - Intronic
925912078 2:8580705-8580727 TGATTGGACACAGTCACCAAAGG - Intergenic
926825824 2:16904139-16904161 TGGTGGCACTCAACCATAAAAGG - Intergenic
927868020 2:26605334-26605356 TGTTGGCAGTCAGTCACCGGGGG + Intronic
928163884 2:28955314-28955336 CGGTGGTACTCAGCCTCCAAAGG - Intergenic
932051480 2:68403029-68403051 TGGTGGTACTCAGGCAAAAAAGG - Intergenic
933079834 2:77972167-77972189 GGGTGTAACTAAGTCACCAATGG - Intergenic
934846994 2:97667888-97667910 TGGTGAGACTCTCTCACCAATGG - Intergenic
935564551 2:104592048-104592070 TGGTGGCACTCAACCATTAAAGG - Intergenic
936030304 2:109065584-109065606 TGGTGGCACTCAGCCTGGAAAGG + Intergenic
936646497 2:114378139-114378161 TGGTGGCCCTCAATCATCAAAGG - Intergenic
938215448 2:129509045-129509067 TGGTGGCACTTAATAACCAAAGG + Intergenic
938563054 2:132491545-132491567 TGGTGGCATGCAATGACCAAAGG + Intronic
938859863 2:135357121-135357143 CAGTGTCACTCTGTCACCAAGGG + Intronic
940606150 2:155926142-155926164 TGGTGGCACTCAACCACCAAAGG - Intergenic
941650655 2:168089064-168089086 CGGTGGTCCTCAGTGACCAAGGG + Intronic
946432997 2:219635503-219635525 TGGGGGCACTCAGCCTCCAAGGG - Intronic
946866717 2:224047544-224047566 TGTTGAAACTTAGTCACCAATGG + Intergenic
947432544 2:230043664-230043686 TGGTGGCCCTCAGACAGCCAGGG - Intronic
948076670 2:235170260-235170282 TGCTGTCACTCAGTCTGCAAAGG + Intergenic
1175390795 20:58626111-58626133 AGGTGGCACTCACTCACAAGGGG - Intergenic
1177912958 21:27054445-27054467 TGACGGCACTCAGCCATCAAAGG + Intergenic
1178061821 21:28861240-28861262 TGGTGGCACTCAACTATCAAAGG + Intergenic
1179383301 21:40919291-40919313 TGGCAGCACTCAATCCCCAAAGG + Intergenic
1180591375 22:16940160-16940182 TGGTGGCACTCAACCCTCAAAGG - Intergenic
1182518633 22:30872844-30872866 GCGTGGCTCTCAGACACCAAGGG + Intronic
1182965603 22:34518594-34518616 TGGCAGCACTCAATCATCAAAGG - Intergenic
949125894 3:444941-444963 TGGCGGCACTCAATCATCAAAGG - Intergenic
951473355 3:23079537-23079559 GGGTGGCACACAGTCATGAAAGG - Intergenic
953897628 3:46814283-46814305 TGGTGGCACTCAACCATCAAAGG - Intergenic
953980625 3:47411182-47411204 TGGCGGCACTCAGTCTCCTGGGG + Exonic
954007946 3:47607996-47608018 TGCTGCCCCTCAGTAACCAAAGG - Intronic
956143223 3:66166695-66166717 TGGGGGTACTCACTCAGCAATGG - Intronic
959227001 3:103599064-103599086 TGGTGGCTCTCAGCCGTCAAAGG - Intergenic
961369893 3:126422805-126422827 AGGTGGCACTCAGTAAACAAGGG + Intronic
962214603 3:133510482-133510504 TGGTGGCACTCAGCTACCAAAGG + Intergenic
962720813 3:138173518-138173540 TGGTGCCACCCAGCCACCATAGG + Exonic
963566681 3:146939210-146939232 TCGTGGCACTCAACCATCAAAGG + Intergenic
963630075 3:147721439-147721461 TGGCAGCACTCAGCCATCAAAGG + Intergenic
964977433 3:162637569-162637591 TTGTGGCACTCAACCACCAATGG - Intergenic
966763280 3:183435884-183435906 TGGCAGCACTCAGTCATCAAAGG + Intergenic
968236836 3:197036865-197036887 TGCAGGAACTCAGGCACCAAGGG + Intergenic
968906640 4:3455852-3455874 TGGCGGCACTCAACCATCAAAGG + Intergenic
969633286 4:8350947-8350969 TGGTGGGCCTCTGTCACCATTGG - Intergenic
970383001 4:15526935-15526957 TGCTGGCACTCAGTCTTCATGGG - Intronic
971817001 4:31503277-31503299 TGGCAGCACTCAATCATCAAAGG + Intergenic
971979522 4:33734648-33734670 TGGCGGCACTCAAACATCAAAGG - Intergenic
972550133 4:40125041-40125063 TGGAGGAACTCAGGCACAAAAGG - Intronic
973121242 4:46523025-46523047 TGGTGGCACTCAACCCTCAAAGG - Intergenic
974458937 4:62163456-62163478 TGGTGGCACTCATCCATCAAAGG + Intergenic
974726852 4:65809679-65809701 TGGTGGCACTCACCCCTCAAAGG + Intergenic
975051283 4:69867781-69867803 TGGTGGTACTCAACCACCAAAGG + Intergenic
975848754 4:78550793-78550815 TGCTTGCACTCAGTCATCACTGG - Intergenic
976034416 4:80797549-80797571 TGGTGGCACTCAACCATCAAAGG - Intronic
977626829 4:99197108-99197130 TGGTGGCACTCAAACATTAAAGG - Intergenic
978899307 4:113928628-113928650 TGGTGGCACTCAACCATCAAAGG - Intronic
979888830 4:126064526-126064548 TGGAGGCACTCAAACATCAAAGG - Intergenic
980628435 4:135405836-135405858 TGGTGGCACTCAACCATCAAAGG + Intergenic
980674638 4:136060272-136060294 GGGTTTCACTCTGTCACCAAAGG - Intergenic
981462562 4:145030011-145030033 TGGCAGCACTCAATCATCAAAGG + Intronic
981979599 4:150775057-150775079 TGGTGGCATTCAGTCACCAAAGG - Intronic
982526970 4:156490615-156490637 TGGTGGCACTCAACCATCACAGG + Intergenic
982702898 4:158675740-158675762 GGGTCTCACTCTGTCACCAAGGG - Intronic
985290172 4:188378722-188378744 ACGGGGCACTCATTCACCAAGGG + Intergenic
986959599 5:13197415-13197437 TGGTGGCACTCAACCATCAAAGG + Intergenic
987152939 5:15059880-15059902 TGGTAGCACTCAACCATCAAAGG + Intergenic
988107537 5:26770732-26770754 TGGCGGCACTCAACCATCAAGGG + Intergenic
988233517 5:28508867-28508889 TGCTGGCACTCAACCATCAAAGG - Intergenic
988264657 5:28931897-28931919 TGGTGGCTCTGAGTGAGCAAAGG + Intergenic
989486613 5:41998165-41998187 TGGTGGCACTCAATCGTCAAAGG - Intergenic
989765355 5:45076250-45076272 TGCTTGGACTCAGTAACCAAGGG - Intergenic
993330756 5:86597089-86597111 TGAGGACAGTCAGTCACCAAGGG + Intergenic
994291612 5:98033760-98033782 TGGTGGCACTCAACCCTCAAAGG - Intergenic
995427975 5:112045555-112045577 TGGTGGCACTCAACCTTCAAAGG - Intergenic
996412961 5:123178930-123178952 TGGCTGCACTCAGAAACCAATGG - Intronic
996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG + Intronic
997574969 5:134967750-134967772 TGGAGGCACTCAGTCTCCTTGGG + Exonic
997695117 5:135855535-135855557 TGGTGGCTCTCACTCACCAGTGG - Intronic
998909251 5:146940589-146940611 AGGTGGCATTCAGTCTCTAAGGG - Intronic
999351154 5:150873065-150873087 TGGCGGCACTCAACCATCAAAGG + Intronic
1000930427 5:167244738-167244760 TGGTGTCTCTCAGTCTCCCAAGG + Intergenic
1002064803 5:176646805-176646827 TGGGGAAACTCAGCCACCAAGGG + Intergenic
1006460895 6:34157310-34157332 TGGTCTCACTCTGTCACCCAGGG - Intergenic
1009452356 6:63816828-63816850 CGTTGGCACTCAGCAACCAAAGG - Intronic
1010325560 6:74558385-74558407 TGGCGGCACTCAGCCATCAAAGG - Intergenic
1010580961 6:77595529-77595551 TGGTGACACTCAACCATCAAAGG - Intergenic
1010818389 6:80386615-80386637 TGGTGGCACTCAACCATCAAAGG + Intergenic
1011331058 6:86206974-86206996 TGTTGGTACTCAATCACCAAAGG - Intergenic
1011745214 6:90402086-90402108 TGGTCCCACACAGTCACAAAAGG - Intergenic
1011782012 6:90800147-90800169 ATGTGGCAGTCAGGCACCAATGG + Intergenic
1012225896 6:96703066-96703088 TGGCAGCACTCAATCACCAAAGG + Intergenic
1012363190 6:98408417-98408439 TGGCTGCACTCAACCACCAACGG - Intergenic
1012944102 6:105447929-105447951 TGGTCTCACTCTGTCACCCAGGG + Intergenic
1014416769 6:121193590-121193612 TGGTGGCACTCAACCATCAAAGG + Intronic
1015467164 6:133560020-133560042 TGGTGGAACTCAACCATCAAAGG - Intergenic
1016144055 6:140647609-140647631 TGGTGGAACTCAGCCATCAAAGG + Intergenic
1016219968 6:141655830-141655852 TGGTGGCACTAAACCATCAAAGG + Intergenic
1016419842 6:143872466-143872488 TGGCAGCACTCAGCCATCAAAGG - Intronic
1017044352 6:150333561-150333583 TGGCAACACTCAATCACCAAAGG - Intergenic
1018535237 6:164812265-164812287 TGGTGGCACTCAATCATCAAGGG - Intergenic
1019002758 6:168769297-168769319 TGGTGGCACTCAACTATCAAAGG + Intergenic
1019040561 6:169100666-169100688 TGGTGGCACTCAACCATCAAAGG + Intergenic
1020396477 7:7723749-7723771 TGGTGGCACTCAGCCGTCAAAGG + Intronic
1020710097 7:11595826-11595848 TGGCGGCACTCAACCATCAAAGG + Intronic
1020839469 7:13197371-13197393 AGGTCTCACTCAGTCCCCAATGG + Intergenic
1021252996 7:18355122-18355144 TGATTGCAGACAGTCACCAAGGG + Intronic
1022600494 7:31753943-31753965 AAGTGGCACTCAATCCCCAAGGG + Intronic
1022924936 7:35047142-35047164 TGGTGGCCCTGAGCCACCAAAGG - Intergenic
1023841786 7:44102223-44102245 TGGGGGCCCTCTGACACCAAGGG - Intergenic
1024086429 7:45895347-45895369 TGGAGGCACTCAACCAACAAAGG - Intergenic
1024859588 7:53823357-53823379 TGGTGGCATTGACTCACCAGGGG - Intergenic
1025156121 7:56607064-56607086 TGGTGACACTCAGCCATCAAAGG - Intergenic
1025761939 7:64403718-64403740 TGGTGGCACTCAGCCATCAAAGG + Intergenic
1027706223 7:81536410-81536432 TGAGAGAACTCAGTCACCAAAGG - Intergenic
1029822947 7:103161847-103161869 TGGTGGCCCTGAGCCACCAAAGG - Intergenic
1030192046 7:106819907-106819929 TGGTGGCACTCATCTATCAAAGG + Intergenic
1031236612 7:119186221-119186243 TGGTGGCACTCAACCACCAAAGG + Intergenic
1031779355 7:125942031-125942053 TGGTGACACTCAACCATCAAAGG - Intergenic
1033075973 7:138250916-138250938 TGGCAGCACTCAGCCATCAAAGG + Intergenic
1036142148 8:6218391-6218413 TGGCGGTACTCAGTGGCCAAAGG + Intergenic
1037019547 8:13952386-13952408 TGGTGTCAGTCAGTCACCAAAGG + Intergenic
1039750458 8:40473745-40473767 TGGGGGCACTCAGCCGACAAGGG - Intergenic
1039923265 8:41907656-41907678 AGGTGGGTCTCAGGCACCAAGGG - Intergenic
1040862174 8:52010470-52010492 TGCAGGCACTCAGTGATCAAGGG - Intergenic
1041934247 8:63319078-63319100 TGGTGGCACTCAATCATCAAAGG + Intergenic
1044150566 8:88771276-88771298 TGGTGGCACTCAACTATCAAAGG + Intergenic
1044286201 8:90414241-90414263 TGGTGGCACTCAACCATCAAAGG - Intergenic
1046173616 8:110545936-110545958 TGGTGGCCCTGAGTGGCCAAAGG + Intergenic
1048084078 8:131158637-131158659 TGGTGGCACTCAACCATCAAAGG - Intergenic
1049476690 8:142800187-142800209 TGGTGGGTCTCTGTCACCACTGG - Intergenic
1049725046 8:144141919-144141941 TGGGGGCACTCAGACTCCACAGG + Intergenic
1053277043 9:36790987-36791009 CTGTGGCACCCAGTCACCAAAGG + Intergenic
1055618964 9:78103649-78103671 TTGAGGCTCTCAATCACCAATGG + Intergenic
1055648981 9:78388575-78388597 TGGTGACACACAACCACCAAAGG + Intergenic
1056314473 9:85374739-85374761 TGGTGGCACTCAACCATCAAAGG - Intergenic
1057236898 9:93368272-93368294 TGGATGCACTCAACCACCAAAGG - Intergenic
1057565780 9:96164772-96164794 TGGTGGCACTCAGATGCCAGAGG - Intergenic
1058468757 9:105255804-105255826 TGGTGAAACTCAGGCACCAAAGG - Intronic
1203433230 Un_GL000195v1:111202-111224 TGGTTGCACTCAGTAGCCAGGGG - Intergenic
1186272840 X:7908238-7908260 TTGTGGCACTGAGTCAGGAAAGG - Intronic
1189171877 X:38917037-38917059 TGGTGACTCTCATTTACCAAAGG - Intergenic
1191769728 X:64741890-64741912 TGGTGGCACTCAACCATCAAAGG - Intergenic
1192995985 X:76513793-76513815 TGGCAGCACTCACTCATCAAAGG + Intergenic
1193155869 X:78173816-78173838 TGGTGGCACTCAGCTGTCAAAGG - Intergenic
1193877055 X:86873521-86873543 TGGCGGCACTCAATCATCAAAGG + Intergenic
1193904372 X:87224771-87224793 TGGTGGCACTCAATCATCAAAGG + Intergenic
1193915043 X:87353726-87353748 TGGTGGCACTCATCCATCAAAGG - Intergenic
1194032227 X:88831649-88831671 TGGTAGCACTCAGCCATCAAAGG - Intergenic
1194108707 X:89803867-89803889 TGTTGGCAATCAACCACCAAAGG - Intergenic
1194443335 X:93959308-93959330 TGGTGGCACTCAATCATCAAAGG + Intergenic
1194604621 X:95963772-95963794 TGGTGGCACTTAACCATCAAAGG - Intergenic
1194849488 X:98853962-98853984 TGGCAGCACTCAGCCATCAAAGG - Intergenic
1195782602 X:108481661-108481683 TGGTGGTACTCAACCGCCAAAGG - Intronic
1196189499 X:112780028-112780050 TGGTGGAACCCAATCACCATTGG - Intronic
1196485101 X:116197209-116197231 TTGTGGCACTCGGCCACCAAAGG + Intergenic
1197097239 X:122611048-122611070 TGATGGCACTCAACCATCAAAGG + Intergenic
1197591626 X:128417550-128417572 TGGTGCCACTCAACCATCAAAGG + Intergenic
1198783275 X:140259593-140259615 TGGTGGCACTCAACCACCGAAGG - Intergenic
1199008258 X:142728669-142728691 TGGTGGCACTCAACCACCAAAGG + Intergenic
1199310640 X:146316056-146316078 TGGTGGCACTCAACCATCAAAGG - Intergenic
1200144238 X:153918250-153918272 TGGTGGCACTGGGTCATCATTGG + Intronic
1200461365 Y:3458595-3458617 TGTTGGCACTCAACCACCAAAGG - Intergenic
1201449021 Y:14089811-14089833 TTGTGGCACTGAGTCAGGAAAGG + Intergenic