ID: 1131304983

View in Genome Browser
Species Human (GRCh38)
Location 15:91234424-91234446
Sequence TGGTGGCACTCAGTCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 2, 1: 2, 2: 12, 3: 64, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131304980_1131304983 -4 Left 1131304980 15:91234405-91234427 CCAGGGTGCAAGGGCCAAGTGGT 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG 0: 2
1: 2
2: 12
3: 64
4: 199
1131304972_1131304983 23 Left 1131304972 15:91234378-91234400 CCTAAATGCAGTGGGAATAATTG 0: 3
1: 2
2: 24
3: 42
4: 252
Right 1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG 0: 2
1: 2
2: 12
3: 64
4: 199
1131304978_1131304983 -3 Left 1131304978 15:91234404-91234426 CCCAGGGTGCAAGGGCCAAGTGG 0: 1
1: 0
2: 4
3: 102
4: 298
Right 1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG 0: 2
1: 2
2: 12
3: 64
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131304983 Original CRISPR TGGTGGCACTCAGTCACCAA AGG Intronic