ID: 1131305863

View in Genome Browser
Species Human (GRCh38)
Location 15:91242612-91242634
Sequence CAGTGTGAAGACTCTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131305859_1131305863 22 Left 1131305859 15:91242567-91242589 CCATGCGAAGATCTGAACAAAGA 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG 0: 1
1: 1
2: 4
3: 64
4: 413
1131305858_1131305863 26 Left 1131305858 15:91242563-91242585 CCAGCCATGCGAAGATCTGAACA 0: 1
1: 0
2: 2
3: 10
4: 88
Right 1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG 0: 1
1: 1
2: 4
3: 64
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131305863 Original CRISPR CAGTGTGAAGACTCTGAGGT GGG Intronic
901181984 1:7348133-7348155 CAGTGAGAAGACAGAGAGGTAGG - Intronic
901336841 1:8456739-8456761 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
901860209 1:12069534-12069556 CAATGTGAAGACTGTGACTTTGG + Intronic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
904386430 1:30145563-30145585 CAGTGAGAAGGCTATGAGTTAGG - Intergenic
904580692 1:31541701-31541723 CAGTGTGAAGGCTCGGAGGCGGG - Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
906187629 1:43872947-43872969 CAGTGCAAAAGCTCTGAGGTGGG + Intronic
907333438 1:53685929-53685951 GAGTGGGGAGAATCTGAGGTGGG - Intronic
907708992 1:56860256-56860278 CTGTGCTAAGACTCTGTGGTTGG + Intronic
908281481 1:62541500-62541522 CAATGTGAAGACAATGAGGATGG + Intronic
908943094 1:69460328-69460350 CTTTGTGTAGAATCTGAGGTAGG + Intergenic
909430089 1:75577435-75577457 AAGTGCGAAGGCTCTGAGGCGGG - Intronic
910160771 1:84270101-84270123 AAGTGTGAAGGCCCTGAGGTAGG + Intergenic
911221931 1:95257278-95257300 AAGTTTGAAGACTCTGAAGATGG + Intergenic
911273458 1:95831657-95831679 CAGACTGAAGAGTCAGAGGTGGG + Intergenic
911374518 1:97035443-97035465 CCATCTGAAGACTCTGAGCTGGG - Intergenic
911394984 1:97294412-97294434 CATTTTGAAGACGGTGAGGTAGG - Intronic
912264086 1:108137957-108137979 ATGTGTGAAGACACTGAGGCAGG - Intronic
912425947 1:109590287-109590309 TTGTGTGAAGACTCTAAGCTGGG - Intronic
912467591 1:109884652-109884674 AAGTGTGAAGGCTCAGAAGTGGG - Intergenic
912870283 1:113297994-113298016 AAGTGCAAAGGCTCTGAGGTAGG - Intergenic
913199355 1:116483647-116483669 CTGAGTGAAGACTCTGAGGCAGG + Intergenic
915432900 1:155880407-155880429 CAGTGGGAAGAGTCTGGGGGAGG - Intronic
915657084 1:157369691-157369713 CATTGTGTATTCTCTGAGGTTGG + Intergenic
915945661 1:160149738-160149760 CAGTGGGGAGAATCTGAGTTTGG + Intergenic
916475193 1:165162391-165162413 CAGGGTGCAGTCTCTGGGGTTGG - Intergenic
916698439 1:167264894-167264916 AAGTGTAAAGGCCCTGAGGTGGG - Intronic
916736536 1:167612293-167612315 CAATGTGGGGATTCTGAGGTTGG - Intergenic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917539590 1:175899845-175899867 CAGTGCGAAGGCCCTGAGGCAGG + Intergenic
917861129 1:179145682-179145704 CAATGCAAAAACTCTGAGGTAGG + Intronic
918130022 1:181619343-181619365 AAGTGTGAAGGCCCTGAGGAAGG + Intronic
918987558 1:191652136-191652158 AAGTATAAAGACCCTGAGGTGGG - Intergenic
919501331 1:198341385-198341407 AAGTGTGAAGACTGAGAGTTTGG + Intergenic
921706622 1:218328888-218328910 CAGTGTGAAGCCTCTATGTTAGG - Intronic
923885659 1:238152375-238152397 CAGTGTGAGGATACTGTGGTGGG + Intergenic
924331357 1:242943910-242943932 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1064773608 10:18751104-18751126 CAGTGTACAGGCCCTGAGGTGGG - Intergenic
1064902865 10:20313532-20313554 ATGTGGGAAGACTCTGAGGCAGG + Intergenic
1065300590 10:24317580-24317602 TAGTGTGGAACCTCTGAGGTAGG + Intronic
1066010238 10:31188117-31188139 CAGTGAGAAGATTCTGATGGAGG - Intergenic
1066600496 10:37100851-37100873 CTGTGTGACGACTCTGAGGCAGG + Intergenic
1067940083 10:50647877-50647899 CAGTGAGGAGGCTCTGAGCTTGG - Intergenic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1068550930 10:58407186-58407208 CAGAGTAAAGACTCAGAAGTGGG - Intergenic
1069621542 10:69840518-69840540 CACTGTGAAGCTGCTGAGGTGGG - Intronic
1070173431 10:73950298-73950320 CTGTGTGGAGGCCCTGAGGTGGG + Intergenic
1070629341 10:78073650-78073672 CAGTTTGAAGACCCTGAGAGAGG - Intergenic
1070948733 10:80413894-80413916 AAGTTTGAAGCGTCTGAGGTTGG + Intronic
1070961325 10:80502146-80502168 CAGTGTCCAGGCTCTGAGGCAGG + Intronic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1071987516 10:91067337-91067359 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1072194711 10:93107261-93107283 GAGTGAGAAGATTCTGAAGTTGG - Intergenic
1072756644 10:98025913-98025935 CAAAGTGAAAACCCTGAGGTGGG + Intronic
1073150572 10:101308701-101308723 CATTGTGTAGCCTCTCAGGTAGG + Intergenic
1074096759 10:110320001-110320023 AAGTGGAAAGACCCTGAGGTGGG + Intergenic
1075220654 10:120581639-120581661 CTGTGGAAAGGCTCTGAGGTGGG - Intronic
1075547085 10:123363143-123363165 ATGTGGGAAGACCCTGAGGTAGG + Intergenic
1075977398 10:126707618-126707640 CAGAGTGGAGACCCTGGGGTGGG - Intergenic
1078869574 11:15330855-15330877 TGGTGTGAAGACCCTGAGGAAGG - Intergenic
1078909868 11:15720876-15720898 CAGTGTCAAGGCCCTAAGGTGGG - Intergenic
1080648151 11:34202325-34202347 CAGTGTGAAGGCTCTGGAGTGGG + Intronic
1080853446 11:36091149-36091171 CTGTGTGGAGGCTATGAGGTTGG + Intronic
1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG + Intronic
1081683304 11:45023885-45023907 AAGTGTGAAGACTTTGAGGCTGG - Intergenic
1081748699 11:45491512-45491534 AAGTGTGATGGCTCTGAGGCAGG + Intergenic
1082960735 11:58916550-58916572 CACTGTGAAGCCTCTGTGGGAGG - Intronic
1083471504 11:62887365-62887387 ATGTGTGAGGACCCTGAGGTGGG + Intronic
1084371099 11:68744059-68744081 CACAGTGAAGAAGCTGAGGTTGG - Intronic
1085236281 11:75017862-75017884 CAGTGACAAGACTGGGAGGTAGG + Intronic
1086271929 11:85078399-85078421 AAGTGTAAAGGCTTTGAGGTAGG + Intronic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1088651174 11:111958949-111958971 CAGAGTGAAGACCCTGGAGTGGG - Intronic
1088771919 11:113043724-113043746 CAATGAGGAGACTCTGAGGAGGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1093441114 12:19197359-19197381 CAGTGTTAAGACCCTGAGGCAGG - Intronic
1095048415 12:37534940-37534962 GAGTTTGAAGACTGTGAGGTGGG - Intergenic
1096272507 12:50177461-50177483 CAGAGTGAAGAGTCTGTGGGTGG - Exonic
1096633663 12:52945316-52945338 CAGTGAGAAGGCCCTGTGGTGGG - Intronic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1099277852 12:80600968-80600990 CAGCGTGAAGACCCTGAGGCAGG - Intronic
1099325335 12:81208112-81208134 CACTGTAAAGATTCAGAGGTGGG + Intronic
1100918238 12:99452919-99452941 AAGTGTGAATACCATGAGGTGGG - Intronic
1101220066 12:102629637-102629659 AAATGTGAAGACTCTGAAGCAGG - Intergenic
1101320480 12:103669015-103669037 AAGTGTGCATGCTCTGAGGTAGG - Intronic
1101364390 12:104058250-104058272 CAGTGTACAGACTGTGAGTTGGG + Intronic
1101662941 12:106782677-106782699 CAGAGGGAAGACTCAGAGGTAGG - Intronic
1101718851 12:107334007-107334029 CAGTGTAAGGGCACTGAGGTGGG + Intronic
1101733574 12:107446126-107446148 CAGTGGGAAGGCACTGAGGCAGG + Intronic
1102296558 12:111741410-111741432 CAGTGTGGAGACTCTAAAATGGG - Intronic
1102456540 12:113074411-113074433 CAGTGAGAAGGCCCTGAGGCTGG + Intronic
1102553924 12:113713333-113713355 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1102712456 12:114940021-114940043 CTGTGTGAAGCCTCTAAGTTTGG - Intergenic
1103015986 12:117494904-117494926 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1103147792 12:118610544-118610566 CAGTTTGAAGACTCTCAAGGGGG - Intergenic
1104847848 12:131855752-131855774 CAGCGGGCACACTCTGAGGTCGG + Intergenic
1105022677 12:132828060-132828082 AAGTTTGAAGACCCTGAGGGCGG - Intronic
1105964898 13:25374693-25374715 CAGAGTGGAGGCTCTGAGATGGG + Intronic
1107391757 13:39972344-39972366 ATGTGTGAAGGCTCTGAGGGAGG - Intergenic
1108000127 13:45898051-45898073 CAGTGTGATGAGGCTGAAGTAGG + Intergenic
1110504526 13:76270352-76270374 GTGTAAGAAGACTCTGAGGTGGG + Intergenic
1111698661 13:91658819-91658841 AAGTGTGAAGGCCCCGAGGTAGG - Intronic
1112468514 13:99666996-99667018 CAGTGTGTAGACACTCAGGTGGG - Intronic
1112520577 13:100091185-100091207 CAGTGGGAAGACATTGATGTTGG + Intronic
1113542477 13:111119767-111119789 CAGTGTCAGGATTCTGGGGTTGG + Intronic
1114297134 14:21340120-21340142 AAGTGTAAAGGCCCTGAGGTAGG + Intronic
1114990939 14:28288681-28288703 CAGTGTGAAGATTCTCATGCTGG - Intergenic
1116178834 14:41509884-41509906 AAGTGTAAAGATTCAGAGGTGGG + Intergenic
1117328957 14:54694004-54694026 AAGTGTGAAGGTTCTGAGGCAGG + Intronic
1117562457 14:56954953-56954975 GAGTCTTAAGACACTGAGGTGGG + Intergenic
1117573966 14:57079007-57079029 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1118978017 14:70694017-70694039 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1119140724 14:72265120-72265142 CAGTATGAAGATTTTCAGGTTGG + Intronic
1119193157 14:72697982-72698004 TTGTGTGAAGACTCTGTGGTGGG - Intronic
1119732865 14:76962102-76962124 CGGTGTGAAGTCTCTGGGGGAGG - Intergenic
1119742498 14:77023436-77023458 GAGTGGGAAGACTGGGAGGTGGG - Intergenic
1119897245 14:78230654-78230676 AATTGCAAAGACTCTGAGGTTGG + Intergenic
1120446683 14:84606997-84607019 CAATGTTATGACCCTGAGGTTGG - Intergenic
1121241941 14:92437264-92437286 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1121582635 14:95042249-95042271 ATGTGTGAGGGCTCTGAGGTTGG - Intergenic
1121740970 14:96252194-96252216 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
1122482154 14:102054300-102054322 CAGAGGGAAGACTCGGGGGTGGG - Intergenic
1122683031 14:103481158-103481180 AGGTGTAGAGACTCTGAGGTGGG + Intronic
1122718224 14:103707837-103707859 CAGTGTGCAGACTCCAAGGGAGG - Intronic
1124871554 15:33548390-33548412 CACTGTGTTGACTCTGAGGCTGG + Intronic
1126745923 15:51826583-51826605 CAGCATAAAGACTCTGAGATGGG + Intergenic
1127634666 15:60857958-60857980 AAGAGTGAGGACTCTGAGATCGG + Intronic
1128368580 15:67022778-67022800 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1128746962 15:70121419-70121441 CAGTGTGAAGGCCCTCAGGGAGG - Intergenic
1129999021 15:80031425-80031447 GAGTGTGAAGACTCTGAGGCAGG + Intergenic
1130094495 15:80845944-80845966 CAGGCTGAAGTGTCTGAGGTGGG - Intronic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1133568982 16:7023087-7023109 CAGTGCAAAGGCACTGAGGTAGG + Intronic
1133844993 16:9445219-9445241 CATTGTGGAGACTCAGAGTTGGG + Intergenic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1135070433 16:19346762-19346784 GAGTGTTCAGACTCTGTGGTTGG + Intergenic
1135964050 16:27021355-27021377 GCGGGTGAAGACTCTGAGGCTGG - Intergenic
1136036100 16:27541754-27541776 CAGAGTGAAGAAACTGAGGTCGG + Intronic
1136097268 16:27966053-27966075 CAGTGCGAAGGCCCTGAGGCAGG - Intronic
1138679154 16:58672483-58672505 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1138707909 16:58936666-58936688 GAGTGGGAAGAGTGTGAGGTGGG + Intergenic
1139522305 16:67491018-67491040 CAGTTTGAAGAGTGTGAGTTTGG + Intergenic
1140050378 16:71475574-71475596 CTGTGTGAATACGCTGATGTTGG + Exonic
1140140539 16:72252464-72252486 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1140183128 16:72740521-72740543 CAGTGTGAAGATGCTGTGATAGG + Intergenic
1140901437 16:79371595-79371617 ATATGTGAAGCCTCTGAGGTGGG - Intergenic
1141157226 16:81605650-81605672 CAGTGCAAAGGCTCAGAGGTGGG - Intronic
1141848788 16:86629956-86629978 CAGTGTGAAGGCCCTGAGGCAGG + Intergenic
1142781016 17:2181276-2181298 TGATCTGAAGACTCTGAGGTGGG + Intronic
1143163347 17:4885462-4885484 CACTGTGAAGACACAGAGGGAGG - Exonic
1143210481 17:5183386-5183408 CAGTGTGAATTCTCTGATGTGGG + Exonic
1143845311 17:9769241-9769263 GAGAGTGAGGACTCTGAGGCAGG - Intergenic
1144487084 17:15675694-15675716 CAGTGTGGATCCTCTGATGTTGG - Intronic
1144601807 17:16622476-16622498 CAGTATGAATTCTCTGATGTAGG + Exonic
1144913944 17:18706622-18706644 CAGTGTGGATCCTCTGATGTTGG + Intronic
1144961120 17:19044749-19044771 CAGTGCCAAGGCTCTGAGGTGGG + Intronic
1144974041 17:19129775-19129797 CAGTGCCAAGGCTCTGAGGTGGG - Intronic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1145411677 17:22671119-22671141 GAGTTTGAAGACTGTGAGGTGGG - Intergenic
1146100959 17:29981354-29981376 ATATGTGAAGACCCTGAGGTAGG - Intronic
1146276754 17:31521245-31521267 CAGTTTGAAGACTATGGGGAGGG + Exonic
1146291414 17:31610218-31610240 CAGTATAAAAACTGTGAGGTGGG + Intergenic
1146772431 17:35581025-35581047 TATTGTGAAGACCCTAAGGTGGG + Intronic
1146897765 17:36557708-36557730 TAGTGTAAAGGTTCTGAGGTTGG + Intronic
1146952723 17:36918131-36918153 CAGTGTGCAGAATCTTAGGGAGG - Intergenic
1147326867 17:39673835-39673857 CTGGGTGAGGACTCTGGGGTAGG - Intronic
1147997359 17:44367931-44367953 CAGTGAAAAGGCCCTGAGGTAGG - Intergenic
1148203687 17:45766232-45766254 CACTGGGATGACTCTGAGCTGGG + Intergenic
1149031394 17:52086883-52086905 CATTTTGAAGACTCTGTTGTAGG + Intronic
1149349441 17:55772283-55772305 CGCTGTCAAGACACTGAGGTGGG + Intronic
1149455612 17:56785776-56785798 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1151751830 17:76043444-76043466 CAGTGTGAGGGATCTGAAGTGGG - Intronic
1152187327 17:78865942-78865964 CAGTGTGACGAAACTGAGCTGGG + Intronic
1152455778 17:80415314-80415336 CAGCCTGAAGACTATGAGCTCGG - Intronic
1153110635 18:1582151-1582173 CAGAGTGAACACTCCAAGGTTGG + Intergenic
1153113075 18:1617601-1617623 TATTGTGAAGAGTGTGAGGTAGG - Intergenic
1153416378 18:4850368-4850390 GAATGTGAAGGCTCTCAGGTGGG - Intergenic
1153625075 18:7015756-7015778 AAGTGTGAAGAATGTGAGGATGG - Exonic
1155778442 18:29798437-29798459 CAATATTAAGACTCTGAGGAGGG + Intergenic
1156718994 18:40046884-40046906 CAGTCAGAAGACTCTGTGATTGG - Intergenic
1157042871 18:44060979-44061001 CAGAGAGGAGACTCTGTGGTGGG + Intergenic
1157247840 18:46070154-46070176 CAGCATGAAGCCTCTGAGGTGGG - Intronic
1158253432 18:55516725-55516747 AAATGTGAAGACCCTGAGGTGGG + Intronic
1158334768 18:56404224-56404246 CAGTTTGAAGGAACTGAGGTGGG + Intergenic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1160802612 19:977271-977293 CTGTGTGAAGGCCCTGAGGCCGG - Intergenic
1161149563 19:2700902-2700924 CCGTGTGAAGACGCTTAGCTGGG + Intronic
1161195381 19:2983531-2983553 CTGTGTGAAGGCCCTGAGGCAGG + Intronic
1161858151 19:6777601-6777623 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1162581566 19:11534349-11534371 TATTGTAAAGACCCTGAGGTGGG + Intergenic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162857399 19:13479415-13479437 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163200981 19:15768989-15769011 TAGTGGGAAGAGTCTCAGGTAGG - Intergenic
1163272975 19:16265401-16265423 CAGTGCCAAGACCCTGAGGCAGG + Intergenic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163780418 19:19244238-19244260 CAGTGTGAAGGCTCAGAGGCAGG - Intronic
1163844508 19:19630641-19630663 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1163844867 19:19632855-19632877 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1164541785 19:29126954-29126976 CACTGGGATGACTCTTAGGTAGG - Intergenic
1165297956 19:34943710-34943732 CAGTGTGAGTACTCTGATGCCGG - Exonic
1165524302 19:36340400-36340422 CAGTGTGAATACTCTGATGTTGG + Exonic
1165556671 19:36639036-36639058 CAGTATGAATCCTCTGATGTAGG + Exonic
1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG + Exonic
1165568020 19:36749035-36749057 CAGTGTGAATTCTGTGATGTTGG + Exonic
1165608460 19:37128548-37128570 CAGTGTGAAGTCTTTGATGTTGG - Exonic
1165650577 19:37485080-37485102 CAGTATGAATTCTCTGATGTTGG - Exonic
1165666564 19:37635157-37635179 CAGTATGAATACTTTGATGTTGG + Exonic
1166052293 19:40267523-40267545 CACAGTGCAGCCTCTGAGGTGGG - Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1166220292 19:41359954-41359976 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1166388113 19:42393341-42393363 CAGTGTGTAGACTCACAGGAGGG - Intergenic
1166604317 19:44127000-44127022 CAGTGTGCAGACTCACAGGCAGG - Intronic
1166879891 19:45922334-45922356 CAGTGCAAAGGCCCTGAGGTTGG + Intergenic
1167090337 19:47339715-47339737 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167687269 19:50964159-50964181 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168171686 19:54594124-54594146 CAGTGTGGACACTCGGAGGCTGG - Intronic
1168446665 19:56423510-56423532 CAGTATGAACTCTCTGATGTTGG - Exonic
925027908 2:624165-624187 TGGTGGGAAGACTCTGAGCTAGG + Intergenic
926172036 2:10558606-10558628 CAGTGTGAGGAAACTGAGGCAGG + Intergenic
926226870 2:10973022-10973044 AAGTGTGAAGGCTCTGAGGCAGG + Intergenic
927670333 2:25063482-25063504 AAGTGTGAAGACCCTGTAGTCGG + Intronic
928314151 2:30232761-30232783 CAGGGTGAAGAGTCTGACGTAGG - Intronic
928535510 2:32236322-32236344 AATTGTGAAGATTCTGAGCTGGG + Exonic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
929642368 2:43594736-43594758 AAGTGTAAAGCCTCTTAGGTGGG - Intronic
929673988 2:43905750-43905772 CAGTGTGAAGCCCTTGATGTGGG + Exonic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
929874864 2:45787913-45787935 CAGTGAGAAGCCTCTGTGGCTGG - Intronic
931179684 2:59886844-59886866 CATTGGGAAGACTCTGGGGTGGG + Intergenic
932293807 2:70607778-70607800 CAGTGTGAAGAGTCTGCTATTGG + Intronic
932297813 2:70641644-70641666 CAGTGTGAAGACTCCTGGGGGGG - Intronic
933083013 2:78017247-78017269 AAGTCTGCAGACTCTGAGGATGG - Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
936904496 2:117521473-117521495 AAGTGGAAAGACACTGAGGTAGG - Intergenic
937164001 2:119795076-119795098 CAGAGAGGAGACCCTGAGGTGGG + Intronic
937237351 2:120438744-120438766 CAGAGTGAAGACTGTTGGGTTGG - Intergenic
937279454 2:120707378-120707400 AGGTGTGAAGCCTCTGAGGTGGG + Intergenic
937906304 2:127054505-127054527 CAGTGTGAAGTCTCTGCCTTTGG - Intronic
938128426 2:128690878-128690900 AGGTGAGAAGACCCTGAGGTGGG - Intergenic
938154709 2:128924430-128924452 CAGTTTGAAGGCTATAAGGTAGG + Intergenic
939199923 2:139020797-139020819 CTCTGGGAAAACTCTGAGGTGGG + Intergenic
939587413 2:144021999-144022021 CAGAGTGTAGCCTCTGAGGAAGG + Intronic
942619093 2:177828671-177828693 CAGTGCAAAGCCCCTGAGGTGGG + Intronic
943166556 2:184334282-184334304 CAGTGGGAAGACTATCAAGTGGG - Intergenic
943259929 2:185646643-185646665 AAGTGGGAAGGTTCTGAGGTGGG + Intergenic
944343268 2:198629772-198629794 CAGTGTGGAGAATTAGAGGTAGG - Intergenic
944869036 2:203891637-203891659 CAATGTCAAGACACTGGGGTAGG + Intergenic
945874443 2:215263693-215263715 CAGTGTTAAGAGGCAGAGGTGGG - Intergenic
945920112 2:215747131-215747153 CTGTACGAGGACTCTGAGGTGGG + Intergenic
946783305 2:223215660-223215682 AAGTGTGAATACTTTGAGGGAGG - Intergenic
946872895 2:224100844-224100866 ATGTGCAAAGACTCTGAGGTGGG - Intergenic
947288292 2:228542895-228542917 GAGTGCAAAGACTCTGAGCTGGG - Intergenic
948340711 2:237249048-237249070 CAGTGTTAAGCCTCTCAGATGGG + Intergenic
948586003 2:239020214-239020236 CAGTGTGAAGGCCCTGCTGTGGG + Intergenic
1168846727 20:950172-950194 CAGTGTGAGGACTCAGAGCAGGG + Intergenic
1169166983 20:3432488-3432510 ACATATGAAGACTCTGAGGTTGG - Intergenic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1171134180 20:22682385-22682407 CAGTGTTAAGACTCAGCAGTGGG - Intergenic
1171256112 20:23690192-23690214 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171263462 20:23752102-23752124 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171272515 20:23827874-23827896 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171284058 20:23923422-23923444 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171845984 20:30275064-30275086 GAGTTTGAAGACTGTGAGGTGGG - Intergenic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1172112099 20:32553061-32553083 CTGTGTGAGGAATCTGAGGACGG - Intronic
1172291473 20:33780206-33780228 CAGTGCCAAGGCCCTGAGGTGGG + Intronic
1173642524 20:44613958-44613980 ATGTGTGAAGGCTCTGAGGGAGG - Intronic
1174361098 20:50029476-50029498 CAGTGTGAAGGCCCTGAGGCAGG + Intergenic
1174363847 20:50044388-50044410 GGATGTGGAGACTCTGAGGTGGG - Intergenic
1174716339 20:52762696-52762718 CAGTTGGGAGACTCTGATGTAGG + Intergenic
1175175842 20:57111597-57111619 CAGTGTGAGGGCTCAGAGCTTGG - Intergenic
1175240755 20:57546571-57546593 CAGTGTGGTGGCTCTGAGGATGG - Intergenic
1175464005 20:59177420-59177442 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1175753110 20:61512844-61512866 CCCTGTGAAGACTGAGAGGTCGG - Intronic
1177045436 21:16163050-16163072 CAGTGTGATGTTTCTGTGGTAGG + Intergenic
1177832038 21:26149911-26149933 CAGTGTAAAGGCTGTGAGGTGGG - Intronic
1178609261 21:34066825-34066847 CAGTGTCATGACACTTAGGTGGG + Intergenic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1180038485 21:45263521-45263543 CAGTGAGAAGATTGTGTGGTAGG - Intergenic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181773412 22:25142998-25143020 CAGTGTGAGGACTCCTTGGTAGG + Intronic
1182936475 22:34227506-34227528 CAGTGCGAAGGCTGTGAGATAGG - Intergenic
1183030281 22:35098789-35098811 CAGTGCCAAGACCCTGAGGCAGG - Intergenic
1183319223 22:37154969-37154991 CAGTGTGAATTGTCTGAGGAGGG - Intronic
1183950540 22:41350176-41350198 CAGACTGAAGTCTCTGAGGCAGG + Intronic
1184681683 22:46075512-46075534 ATGTTTGAAGTCTCTGAGGTGGG - Intronic
1185210506 22:49568274-49568296 GAGGGTGCAGACTCAGAGGTGGG - Intronic
950044925 3:9943425-9943447 CAGTGTGAAAACACCGAGGGCGG + Exonic
950456988 3:13098622-13098644 CAGTGGAAAGGCTCTGAGCTAGG + Intergenic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
951287261 3:20828445-20828467 CAGTGTGAATACTTTGAGTTCGG - Intergenic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
954524622 3:51258887-51258909 CAGTTTGAAGTCACTGAAGTAGG - Intronic
957510259 3:81179186-81179208 CAATGTGATGATTCGGAGGTGGG + Intergenic
957819223 3:85348207-85348229 CAATATGAAGGCTCTCAGGTGGG + Intronic
958582554 3:96045239-96045261 CTGTGTGTAGCCTCTGAGCTTGG - Intergenic
960300655 3:115999067-115999089 CAGTATTAACACTCTGAGCTGGG - Intronic
960622579 3:119651187-119651209 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
962188057 3:133280948-133280970 CAGTGTGAAAGCTTTAAGGTTGG - Intronic
962302372 3:134253658-134253680 CAGTGCAAAGGCCCTGAGGTAGG - Intergenic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
964174156 3:153805239-153805261 ATGTGTGAAGGCTCTGAGGCAGG - Intergenic
964769466 3:160209400-160209422 AAGTTTGAAGACACTGTGGTAGG - Intergenic
965611485 3:170548496-170548518 TACTGTGAAGACCCAGAGGTGGG - Intronic
965764290 3:172113830-172113852 CAGAGTGAAGACTGTAAAGTGGG - Intronic
965788777 3:172365034-172365056 CAGTTTCAAGACACTGAGGAAGG - Intronic
966977336 3:185096648-185096670 CAGTGTGAAGGGTCTGCGGGAGG + Intronic
968182837 3:196609933-196609955 CAGTGTGATGCCTCTGGGGTAGG - Intergenic
968817905 4:2831293-2831315 CGGTGTGATGACACTGAGCTTGG + Intronic
969083260 4:4636582-4636604 AAGTGCGAAGACCCTGAGGTGGG + Intergenic
970940349 4:21625537-21625559 CTGTGAGAAGGCTCTGAGTTAGG - Intronic
971109478 4:23567708-23567730 CACTGTGGAGAGGCTGAGGTGGG - Intergenic
971272811 4:25166578-25166600 CAGTGTGAAGACCTTCATGTGGG - Intronic
971296521 4:25398434-25398456 AAGTGTGAAGGCCCTGAGTTTGG + Intronic
972205420 4:36766169-36766191 CAGAGAGAAGGCTCTGAGATGGG + Intergenic
972416279 4:38843649-38843671 AAGAGTGAAAACTCTGAGTTGGG + Intronic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973333164 4:48930521-48930543 AAGTGCAAAGACCCTGAGGTTGG + Intergenic
973771365 4:54210015-54210037 CAGTGTGCAGATCCAGAGGTGGG + Intronic
973971978 4:56222370-56222392 CACTTTGGAGACTCTGAAGTGGG + Intronic
974602001 4:64095364-64095386 CAGTGTGAACAGTTTGAGATTGG - Intergenic
975575705 4:75860442-75860464 CTTTGTGAAGATTGTGAGGTGGG + Exonic
975855982 4:78624842-78624864 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
978219701 4:106256002-106256024 CAGAGAGAAGACCCTGGGGTGGG + Intronic
979314635 4:119247316-119247338 CAATGAGAAGACTTTGAGGTGGG - Intronic
980501833 4:133666060-133666082 CAGTGGAAAGGCCCTGAGGTAGG - Intergenic
981730549 4:147892666-147892688 CAGTTTGGAGACTCAGAGGAAGG + Intronic
981903218 4:149890700-149890722 CAGTGGGGAGACTCTGAGGCTGG - Intergenic
982091225 4:151881594-151881616 CAGTGCAAAGGCCCTGAGGTAGG + Intergenic
982627666 4:157787790-157787812 CCATGGGAAGGCTCTGAGGTTGG - Intergenic
983780156 4:171660459-171660481 CTGTTTGAAGACTCTGAACTAGG + Intergenic
985962469 5:3312924-3312946 CACTGTGAAGGTACTGAGGTTGG - Intergenic
988864831 5:35323882-35323904 CAGAGGGAAGACACTGAAGTGGG + Intergenic
988918948 5:35923036-35923058 AAGGATCAAGACTCTGAGGTGGG - Intronic
989110610 5:37903533-37903555 CAGTGGAAAGGCCCTGAGGTGGG + Intergenic
989732314 5:44663773-44663795 CAGTATGAAGATTATTAGGTGGG - Intergenic
990056755 5:51591160-51591182 CAGTGTGAAGACTCTAGGGCAGG + Intergenic
991722662 5:69508287-69508309 CACAGTGGAGAGTCTGAGGTGGG - Intronic
991915016 5:71597180-71597202 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
992424836 5:76646277-76646299 CAGTGTGACAATTCTGAGATGGG - Intronic
992679612 5:79141009-79141031 CAGTGCCAAGGCTCTGAGGTAGG - Intronic
994728356 5:103462844-103462866 CAGTGTGAATGCTGTGAGGTGGG - Intergenic
995238374 5:109857143-109857165 AAGTGTGAAGGCCCTGAGGCCGG + Intronic
995834972 5:116391065-116391087 CCTTGTGAAGACTATGAGGATGG + Intronic
997880416 5:137584092-137584114 CAGTGTGAAGGATCTCAGGCTGG - Intronic
998001487 5:138629444-138629466 CTTTCTGAACACTCTGAGGTGGG + Intronic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998987538 5:147777289-147777311 AAGTGTGAACACTCTCAAGTGGG + Intronic
998999170 5:147900974-147900996 CATTGGGAAGACTCTGGGATTGG + Intronic
999261874 5:150243356-150243378 CTGTGTGGAGACGCTGAGCTAGG - Intronic
999428106 5:151504838-151504860 CAGTGGTGTGACTCTGAGGTGGG + Exonic
999636805 5:153631570-153631592 CAGAGAGACGACTCTAAGGTTGG + Intronic
999637375 5:153636617-153636639 CAAAGTGAGGACTCTGAAGTTGG + Intronic
1000348298 5:160332622-160332644 AAGTGTGGAGGCCCTGAGGTGGG - Intronic
1000521507 5:162300111-162300133 CAGTGTGGGGACTCTGCGGTGGG + Intergenic
1000987343 5:167875303-167875325 AAGTGTGAAGACTCTGAAGGTGG + Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1002397021 5:178965688-178965710 CAGTATGAATTCTCTGATGTTGG - Exonic
1003276515 6:4658604-4658626 AAGTGCGAAGGCCCTGAGGTGGG + Intergenic
1005700012 6:28391230-28391252 CTGTGTGAAGTCTCTGATGTTGG + Exonic
1006451186 6:34106615-34106637 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006744572 6:36332199-36332221 CAGTGTGAAGGGCCTGAGGCAGG - Intronic
1006905264 6:37528943-37528965 CAGTGTGCAGACTCGGGGGCTGG - Intergenic
1007039215 6:38705975-38705997 GACTGTGAAGACCCGGAGGTGGG - Intergenic
1007219946 6:40270505-40270527 AAGTGTGAAGACCATGAGATAGG - Intergenic
1007683619 6:43651312-43651334 CAGTGGGTAGGCTCTGGGGTGGG + Intronic
1007926475 6:45653499-45653521 AAGTGTAAAGGCACTGAGGTGGG + Intronic
1009894896 6:69735957-69735979 AAGTGTGAGGATCCTGAGGTGGG - Intronic
1011430759 6:87284170-87284192 AAGTGTGAAGATTCTGGAGTAGG + Exonic
1014459765 6:121682510-121682532 CAGTGTAAGGTCTCTGAGGGAGG + Intergenic
1015143330 6:129959035-129959057 CAGAGAGGAGACCCTGAGGTGGG - Intergenic
1018140578 6:160829928-160829950 CTGTGTGAAGAGTTAGAGGTAGG + Intergenic
1018450475 6:163902757-163902779 CAGTGTGAAGGCCCTGAAGGTGG + Intergenic
1018891466 6:167986097-167986119 CGGTGTGAAGTCCCCGAGGTGGG - Intergenic
1019322228 7:420949-420971 CACTGTGGAGTCACTGAGGTTGG - Intergenic
1020579057 7:9971477-9971499 CCCAGTGAAGACTCTGTGGTGGG - Intergenic
1021861086 7:24906625-24906647 ATGTGTGAAGACACTGTGGTAGG - Intronic
1022202683 7:28132853-28132875 CGGTGTGAAGGCTCAGAGATGGG - Intronic
1023138828 7:37080843-37080865 CAATGTGAAGACCCTGAGGCAGG - Intronic
1025294328 7:57763527-57763549 GAGTTTCAAGACTGTGAGGTGGG - Intergenic
1026042368 7:66878697-66878719 CAGTTTAAAGACTCTGATATAGG - Intergenic
1027522684 7:79229950-79229972 CACTCTGAAGACTGTGAGGGTGG - Intronic
1028724829 7:94075282-94075304 CAGTTTGAAGACTATCAGGCAGG + Intergenic
1030278581 7:107745378-107745400 AAGTGCGAAGGCACTGAGGTAGG + Intronic
1031070471 7:117155900-117155922 CAGTGTAAAGTTTCTGAGGTGGG - Intronic
1032527430 7:132589920-132589942 CAGTGCAAAGGCTGTGAGGTGGG + Intronic
1033908666 7:146238400-146238422 CAATGTGAAGAGCCTGAGGTTGG + Intronic
1034333976 7:150308590-150308612 GATTCAGAAGACTCTGAGGTTGG - Intronic
1034409755 7:150934163-150934185 CAGTGAGAAAACATTGAGGTAGG + Intergenic
1034413713 7:150954413-150954435 CTGTGTGCAGACTCAGGGGTAGG - Intronic
1036043472 8:5113143-5113165 TAGTATGAAGTGTCTGAGGTGGG - Intergenic
1036382992 8:8250951-8250973 ATGAGTGAAGGCTCTGAGGTGGG + Intergenic
1038373577 8:27015631-27015653 TAGTGTGAGGATTCTGAGGAGGG - Intergenic
1038422017 8:27439529-27439551 CACTGAGAAGTCTCAGAGGTGGG + Intronic
1039252241 8:35679450-35679472 AGGTATGAAGGCTCTGAGGTTGG + Intronic
1042230682 8:66551322-66551344 CAGTGAGAAAACTATTAGGTTGG + Intergenic
1042607038 8:70555723-70555745 TATTGTGGGGACTCTGAGGTAGG + Intergenic
1042704435 8:71651176-71651198 CAGTTTGTAGACTCTGTGTTTGG - Intergenic
1043333414 8:79144837-79144859 CAGTATGGAGACTTTCAGGTTGG + Intergenic
1043758339 8:84031967-84031989 CAGAGAGGAGACTCTGTGGTCGG - Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1045102569 8:98860407-98860429 AAGTGTGAAGGCCCTAAGGTGGG + Intronic
1045181003 8:99782593-99782615 CAGAGGGAAGGCTCTGAGGCAGG + Intronic
1045325968 8:101118010-101118032 GACTGTGAAGCCTCTGAGCTGGG - Intergenic
1046345678 8:112923474-112923496 AAGTGTAAAGACCCTGAGGGAGG - Intronic
1047303077 8:123631502-123631524 AAATGTAAAGATTCTGAGGTGGG + Intergenic
1048276529 8:133070212-133070234 CAGTGTGACATCTCTGAGGACGG + Intronic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1049630319 8:143650961-143650983 CAGTGTGAATTCTCTGATGCTGG - Exonic
1049834082 8:144722207-144722229 CAGTGTGAACTCGCTGATGTAGG + Exonic
1049841207 8:144773706-144773728 CAGTGTGAATTCTCTGATGTTGG + Exonic
1049871026 8:144976541-144976563 CAGTGTGAATTCTCTGATGTTGG + Intergenic
1049871093 8:144977213-144977235 CAGTGTGAATTCTCTGATGCTGG + Intergenic
1050163021 9:2737540-2737562 CAGGGCGACGATTCTGAGGTTGG - Intronic
1050728839 9:8684043-8684065 CAATGAGAAGACTCTAAGGAGGG - Intronic
1050869600 9:10550546-10550568 CAGTGTGGTAATTCTGAGGTAGG - Intronic
1050915789 9:11130131-11130153 CAGTGTGGAGTCTCTGAGAAAGG - Intergenic
1053355426 9:37441599-37441621 CAGTGTGAAAACCCTGAGGTTGG - Exonic
1054162094 9:61680778-61680800 GAGTTTGAAGACTGTGAGGTGGG + Intergenic
1055328516 9:75157673-75157695 TAGTGTCAAGCCTCTGAGTTTGG - Intergenic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1055654095 9:78436496-78436518 AAGTGAGAAGACTGTGAGGTAGG + Intergenic
1055684253 9:78753605-78753627 CATTGTTTAGACTCTCAGGTTGG + Intergenic
1055971734 9:81918790-81918812 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055973486 9:81933862-81933884 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055975240 9:81948954-81948976 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055980274 9:81994118-81994140 CAGTGAAATGGCTCTGAGGTTGG - Exonic
1057354964 9:94325260-94325282 CAGTGTCAGGACTCTGGGGAAGG + Exonic
1057508978 9:95662164-95662186 GAGTGTGGATACTCAGAGGTGGG + Intergenic
1057652788 9:96932374-96932396 CAGTGTCAGGACTCTGGGGAAGG - Exonic
1057739051 9:97696156-97696178 GAGTGAGAAGAGTCTGAGGCTGG - Intronic
1058107403 9:100988491-100988513 CAGTCAGAAGACTCTGACCTGGG + Intergenic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1059109579 9:111542720-111542742 CAGTGTGAATTCTCTGATGCCGG - Exonic
1059495071 9:114702695-114702717 CAGTTTCCAGACTCTGACGTGGG - Intergenic
1060383791 9:123203557-123203579 AAGTGGAAAGGCTCTGAGGTGGG - Intronic
1060975864 9:127764610-127764632 AAGTGCAAAGACCCTGAGGTGGG - Intronic
1060985829 9:127818469-127818491 CACTGTGAGGACTCAGGGGTGGG - Intronic
1203787523 EBV:136276-136298 CCGCGTGGAGACTCTGAGGCAGG + Intergenic
1185735900 X:2495910-2495932 CAGTGTGAAGAAGCAGAGGAAGG + Intronic
1186092299 X:6062956-6062978 CAGTGCCAAGGCTCTGGGGTAGG - Intronic
1186501415 X:10053699-10053721 CAGATTGAAGACTCTGAGGCTGG + Intronic
1188440958 X:30215185-30215207 CAAGGTGAGGACTCTGAGGGCGG + Intergenic
1189091758 X:38090867-38090889 CAGTGTGGAGCCCCTGAGGTGGG + Intronic
1189644317 X:43110216-43110238 CAGTGAGACAACTCAGAGGTTGG + Intergenic
1189709415 X:43794222-43794244 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1190062928 X:47222584-47222606 CAGTGTAAAGGCCCCGAGGTGGG + Intronic
1190221794 X:48516677-48516699 CAGTGGAAAGGCCCTGAGGTAGG + Intronic
1191718604 X:64210313-64210335 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1192012804 X:67293413-67293435 CAGTGGGATGAATCTGATGTTGG - Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1193300258 X:79881056-79881078 CAGAGTGAAGAAACTGAGGGTGG + Intergenic
1193554178 X:82932817-82932839 GAGAGAGAAGACTCTGGGGTGGG - Intergenic
1195670558 X:107466332-107466354 CAGTGGCAAAACTGTGAGGTTGG - Intergenic
1195736922 X:108021122-108021144 CAGTGTGGAAACTATGAGTTGGG + Intergenic
1197563684 X:128054574-128054596 CTGTTTGTAGACTCTTAGGTTGG + Intergenic
1197809515 X:130428969-130428991 AAGTGCAAAGACCCTGAGGTGGG + Intergenic
1198245039 X:134822478-134822500 TAGTGTGAAATGTCTGAGGTAGG - Intronic
1198506565 X:137307191-137307213 TAGTGTGAAGGCTCTGTGGTAGG - Intergenic
1198789457 X:140327758-140327780 AAGTGTGAAGACCCGGAGGCAGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1200038320 X:153347360-153347382 AAGTGTGAAGTTTCTGATGTCGG - Exonic
1201228698 Y:11843045-11843067 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
1201550768 Y:15214329-15214351 CAGTGTTAGGACACTGAGGGAGG + Intergenic
1201796936 Y:17906049-17906071 CAGAGTGAAGACCCTGGAGTGGG - Intergenic
1201804617 Y:17999936-17999958 CAGAGTGAAGACCCTGGAGTGGG + Intergenic
1202250547 Y:22866597-22866619 CAGTATTAAGTCTCTGATGTTGG + Intergenic
1202358312 Y:24075108-24075130 CAGAGTGAAGACCCTGGAGTGGG - Intergenic
1202403536 Y:24500346-24500368 CAGTATTAAGTCTCTGATGTTGG + Intergenic
1202467243 Y:25169736-25169758 CAGTATTAAGTCTCTGATGTTGG - Intergenic
1202512466 Y:25595005-25595027 CAGAGTGAAGACCCTGGAGTGGG + Intergenic