ID: 1131308195

View in Genome Browser
Species Human (GRCh38)
Location 15:91264408-91264430
Sequence AGGCTTTTATAGGTCGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131308193_1131308195 -4 Left 1131308193 15:91264389-91264411 CCTAAGGAGCACGAGGGAGAGGC 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1131308195 15:91264408-91264430 AGGCTTTTATAGGTCGAACATGG 0: 1
1: 0
2: 6
3: 18
4: 91
1131308191_1131308195 -3 Left 1131308191 15:91264388-91264410 CCCTAAGGAGCACGAGGGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1131308195 15:91264408-91264430 AGGCTTTTATAGGTCGAACATGG 0: 1
1: 0
2: 6
3: 18
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131308195 Original CRISPR AGGCTTTTATAGGTCGAACA TGG Intronic
903101762 1:21035909-21035931 AGGCTTTTATGGGCCTTACAGGG - Intronic
907825120 1:58008702-58008724 AGTCTTTCATAGGTGGAAGATGG - Intronic
908621683 1:65988066-65988088 AGGATTTTATATTTCAAACAGGG + Intronic
910188677 1:84573267-84573289 GGGCTTTTATAGGCCGAACAGGG - Intronic
914502704 1:148261522-148261544 AGGTTTTTAAAGGTCAAAAAGGG - Intergenic
916745563 1:167682456-167682478 AGGCTTTGACAGGCCGGACATGG - Intronic
919305076 1:195822064-195822086 ATGCTTTTTTAGGTCGGGCACGG + Intergenic
920573513 1:207036715-207036737 AGGATTTTATAGGAAAAACATGG - Intronic
924274143 1:242368234-242368256 AGGCTTTTATAGGGTGAATACGG - Intronic
1064174967 10:13066880-13066902 AGGGTTTTATTGGGCGAAAAGGG - Intronic
1067072515 10:43145255-43145277 AGACTTCTATAGGATGAACAAGG + Intronic
1068198991 10:53758325-53758347 AAGCTTTTATAGGCTGAACATGG - Intergenic
1068296634 10:55079952-55079974 AGGCTCTAGTAGGTAGAACAGGG + Intronic
1071780766 10:88841854-88841876 AGGCTTTTATAGGGTGAAAAAGG - Intronic
1071968816 10:90881680-90881702 AAGCTTTTATAGGTATATCATGG + Intronic
1077878062 11:6324340-6324362 GAGCTTTTATAGGCTGAACATGG + Intergenic
1082077728 11:47987276-47987298 ATGATTTTATAGGTCGAATGAGG + Intronic
1084536407 11:69759888-69759910 AGGCATTTCTAGGTGGAACATGG + Intergenic
1088092816 11:106063317-106063339 AAGCTTTTATAGGTTGAACATGG - Intronic
1088649814 11:111947540-111947562 GGGCATTTATAGGAAGAACAGGG + Intronic
1093896740 12:24583290-24583312 TGGCTTTTATAGGAGAAACATGG - Intergenic
1095376195 12:41531512-41531534 AGGCTTTTATAGGCCCAGGATGG + Intronic
1097969912 12:65622353-65622375 ATGCTTTTATAGGGTGAGCACGG + Intergenic
1099242504 12:80154492-80154514 GAGGTTTTATAGGACGAACATGG - Intergenic
1104825879 12:131709481-131709503 AAGCTTTTATAGACCCAACACGG + Intergenic
1107319875 13:39174955-39174977 AGTGTTTTATTGGTGGAACATGG - Intergenic
1109426251 13:62168544-62168566 AGGCTTTTATAAGTCTCAGAGGG - Intergenic
1109479650 13:62932705-62932727 AGGCTTTTATACAGAGAACATGG + Intergenic
1110794546 13:79621558-79621580 AGGCTTTTATAGGGTGAACATGG + Intergenic
1111255354 13:85660749-85660771 AAGCTTTTATAGGGTGAGCATGG + Intergenic
1112202402 13:97290048-97290070 AGACTTTTATAGGAGAAACATGG - Intronic
1112549872 13:100409414-100409436 AGGGTTTTATAGGGTGAAAAGGG + Intronic
1114539964 14:23447779-23447801 AGGCTTTTACAGGAGGAACATGG + Intergenic
1121224991 14:92315175-92315197 AGGTTTTTATGGGTCAAACCTGG - Intergenic
1128965291 15:72052031-72052053 AGGCTTTTATAGGTCTCAGCAGG - Intronic
1131308195 15:91264408-91264430 AGGCTTTTATAGGTCGAACATGG + Intronic
1131868732 15:96739283-96739305 AGGCTTTTATGGGGTGAACACGG + Intergenic
1135428179 16:22357814-22357836 AGGTTTTTATATATCAAACAAGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1142603118 17:1066882-1066904 AGGATTTCATAGGGCTAACATGG - Intronic
1145358916 17:22194475-22194497 AGGCTTTTATACAGAGAACATGG - Intergenic
1156782412 18:40866591-40866613 AGGGTTTTATTGGGCGAAAAAGG - Intergenic
1156818012 18:41335360-41335382 AAGCTTTTATGGGACTAACATGG - Intergenic
1158743878 18:60175212-60175234 AGGCTTTTATTGGATGAACATGG - Intergenic
1163368839 19:16890635-16890657 AGGCTGTACTGGGTCGAACAGGG + Exonic
924963893 2:58096-58118 GGGCTTTTATAGGTCTCAGAGGG - Intergenic
925551236 2:5077571-5077593 AGGCGTTTATAGGATGTACATGG - Intergenic
927145241 2:20161060-20161082 AGGCTTTTATAGGATGAAAAGGG - Intergenic
928898940 2:36297201-36297223 AGGATTTTAGAGGATGAACAAGG - Intergenic
940396259 2:153196037-153196059 AGGCTTTTATAGACCTAAGAAGG + Intergenic
943244639 2:185431228-185431250 AGCTTTTTATAGGTAGTACATGG + Intergenic
945113611 2:206389215-206389237 AGACTTTTATAGGTGCAAGATGG + Intergenic
1168865624 20:1083628-1083650 AGGCTTTTATAGGGTGAATGTGG - Intergenic
1169615067 20:7432585-7432607 AGGCTTTTATAGAGTGAAAATGG + Intergenic
1169641479 20:7757222-7757244 AGGCTTCTTGAGGTGGAACAGGG + Intergenic
1170145151 20:13165300-13165322 ATGCTTTTATGAGTGGAACAAGG - Exonic
1173152523 20:40579771-40579793 AGGCTTTGATAGGTAGAATTTGG - Intergenic
1174847073 20:53952799-53952821 AAGATTTTATAGGCCAAACATGG - Intronic
1179465863 21:41572222-41572244 GAGCTTTTATAGGCTGAACATGG + Intergenic
1182193941 22:28494577-28494599 AGGCTTTTATAGGATGAACAAGG - Intronic
951470633 3:23052431-23052453 AGGCTTTTACAGGGCAGACAAGG - Intergenic
954914532 3:54137467-54137489 AGGCTTTTATAGGAAGCAGATGG - Intronic
956019573 3:64919810-64919832 AAGCTTTTATAGGATGAACATGG - Intergenic
965660528 3:171037076-171037098 AGGCTTTTAAAAGTGGATCAAGG - Intergenic
966841908 3:184096498-184096520 AGGCTCTTATAAGTGGAAGAAGG + Intergenic
968178323 3:196569869-196569891 AGGCTTTTATAGAACGTCCACGG + Intronic
969416264 4:7061644-7061666 AGGCATTTACAGGTCGGAAAGGG + Intronic
971795459 4:31221180-31221202 AAGCTTTTATAGGCTGAACATGG + Intergenic
972693075 4:41418773-41418795 AGGCTTTTAAAGGGCTGACACGG + Intronic
973948303 4:55983808-55983830 AGGCTATTACAGGTCGGGCATGG - Intronic
975222745 4:71832340-71832362 AGGGTTTTATTGGGCGAAAAGGG - Intergenic
975970816 4:80034471-80034493 AGGCTTTTATAGAACCAACGTGG + Intronic
976010409 4:80480370-80480392 GGGCTTTTATAGGATGAAAAAGG + Intronic
978390564 4:108220821-108220843 AGTCTTTTAAAGGTCAAACCAGG - Intergenic
979422809 4:120527170-120527192 GGGCTTTTATAGGCTGAACATGG + Intergenic
979958503 4:126987021-126987043 AGGTTTTTTTAGGTTGAACATGG + Intergenic
983088385 4:163474596-163474618 AGGCTTTTATAGGGTGAATTTGG - Intergenic
983767705 4:171506444-171506466 AGGCTTTTATTAGTTGAAGAGGG + Intergenic
984313116 4:178090203-178090225 AGGTTTTTATAGCTCAAACTGGG - Intergenic
984722172 4:182983780-182983802 AAGCTTTTATAGACAGAACACGG + Intergenic
986108933 5:4692046-4692068 AGGCTTTTATAGGACAAACATGG + Intergenic
988664742 5:33313325-33313347 AAGCTTTTATAGGCTTAACATGG - Intergenic
991064125 5:62407717-62407739 AGGCTTTTATAGGGTGAATGTGG + Intronic
992524958 5:77600119-77600141 AAACTTTCATAGGTCAAACATGG + Intronic
994599328 5:101882039-101882061 ACCCTCTTATAGGTCAAACAGGG + Intergenic
996280718 5:121726489-121726511 AGGCCTTTATAGTGCGATCAGGG + Intergenic
1001057706 5:168462953-168462975 ATGCTCTTCTAGGTTGAACATGG - Intronic
1001271240 5:170313439-170313461 GAGCTTTTATAGGCTGAACATGG + Intergenic
1003594322 6:7460911-7460933 AGGCTTTTACAGGGTGAACACGG + Intergenic
1006204920 6:32332132-32332154 AGGCTTTGAGAGGTAGAGCAGGG + Intronic
1007023159 6:38543087-38543109 AGGCTTGTACAGGTAGAACATGG - Intronic
1014538203 6:122642133-122642155 GGGCTTTTATAGTCTGAACATGG - Intronic
1016161902 6:140893444-140893466 AGGGTTTTATTGGGCGAAAAGGG + Intergenic
1016578999 6:145607068-145607090 AGGCTTTTATAGGGTGAACATGG - Intronic
1022571298 7:31456641-31456663 AGGCCTTTCTAGGTAGGACAAGG - Intergenic
1023189537 7:37564889-37564911 AGAGTTTTATAGGTACAACATGG + Intergenic
1025039903 7:55632635-55632657 AGGCTTTTAAAAGTCTAACCTGG + Intergenic
1031219031 7:118940052-118940074 AGGTTTTTATAGAATGAACATGG - Intergenic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1036138928 8:6188525-6188547 CAGCTTTTATAGGCCAAACATGG - Intergenic
1036290023 8:7479342-7479364 AGGCTTTTATAGGGTGAAAATGG + Intergenic
1036331453 8:7832181-7832203 AGGCTTTTATAGGGTGAAAATGG - Intergenic
1040957934 8:52998734-52998756 CGGCTTTTATAAGGTGAACACGG - Intergenic
1040988168 8:53318882-53318904 AGACTTTCATAGGATGAACAAGG - Intergenic
1042646775 8:70995840-70995862 AGGCCTTTATAAGTGGAAAATGG - Intergenic
1046528358 8:115411013-115411035 AGGCTTTAATATGTCAAAAAAGG + Exonic
1047650628 8:126916285-126916307 AGGCTTTTATAGGATGAATATGG - Intergenic
1050111082 9:2216910-2216932 GAGCTTTTATAGGACAAACATGG - Intergenic
1051593372 9:18798912-18798934 AGTATTTTATAGGCCAAACAGGG - Intronic
1053520044 9:38768335-38768357 AAGCTTTTGTAGGTTGAGCAAGG - Intergenic
1055262855 9:74459109-74459131 AAGCTTTTATAGGCTGAGCAGGG - Intergenic
1189940840 X:46119015-46119037 AGGCTTTTATAGGGTGAATGTGG - Intergenic
1191190906 X:57666184-57666206 AGGTTTTTATAGGTAGAAAATGG - Intergenic
1193241832 X:79179584-79179606 AGGCTTTTATAGTTTGAATGTGG - Intergenic
1196440577 X:115716211-115716233 AGGCATATTTAGGTCAAACAGGG - Intergenic
1197213048 X:123843974-123843996 AGGGTTTAATAGGTGAAACAAGG + Intergenic