ID: 1131308827

View in Genome Browser
Species Human (GRCh38)
Location 15:91269366-91269388
Sequence GAGCTTGCTAAGTACAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131308827_1131308832 8 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308832 15:91269397-91269419 GTGAATGGTAAGTAAATGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 231
1131308827_1131308833 14 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308833 15:91269403-91269425 GGTAAGTAAATGGGTGGCCATGG 0: 1
1: 0
2: 0
3: 14
4: 147
1131308827_1131308831 5 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308831 15:91269394-91269416 GTTGTGAATGGTAAGTAAATGGG 0: 1
1: 0
2: 1
3: 20
4: 174
1131308827_1131308830 4 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308830 15:91269393-91269415 GGTTGTGAATGGTAAGTAAATGG 0: 1
1: 0
2: 3
3: 14
4: 201
1131308827_1131308829 -7 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308829 15:91269382-91269404 CAAGCTCATCAGGTTGTGAATGG 0: 1
1: 0
2: 1
3: 11
4: 120
1131308827_1131308835 26 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308835 15:91269415-91269437 GGTGGCCATGGGCTATACAGTGG 0: 1
1: 0
2: 0
3: 14
4: 131
1131308827_1131308834 15 Left 1131308827 15:91269366-91269388 CCTGAACTGTACTTAGCAAGCTC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1131308834 15:91269404-91269426 GTAAGTAAATGGGTGGCCATGGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131308827 Original CRISPR GAGCTTGCTAAGTACAGTTC AGG (reversed) Intronic
904908110 1:33913187-33913209 GTGCTTGCCAAGTGCAGCTCTGG + Intronic
908429656 1:64043500-64043522 GAGCTTTTTAAATACAGTGCAGG - Intronic
912575336 1:110665900-110665922 GACCTTGCCAAGTACACTTTTGG + Intergenic
913079992 1:115374896-115374918 GAGCTTGAAAAGAACAGTTGAGG - Intergenic
920089669 1:203443265-203443287 GACCTTGAGAAGTACTGTTCTGG - Intergenic
1062984268 10:1753012-1753034 AGGCTTGCTAACTACAGATCTGG - Intergenic
1068094469 10:52473079-52473101 GAGCTGGTTAAATACAGTGCTGG + Intergenic
1068943121 10:62701047-62701069 CAGCTTACTATGGACAGTTCTGG + Intergenic
1069752932 10:70756054-70756076 TATTTTGGTAAGTACAGTTCAGG - Intronic
1070015931 10:72531267-72531289 TAGCTTTCTAACTACATTTCTGG + Intronic
1074172585 10:110957736-110957758 TAGATTGCCAAGTACAGTTTTGG + Intronic
1074601205 10:114915447-114915469 GAGCTTGCTGCTTACACTTCAGG - Intergenic
1077632937 11:3823455-3823477 GAGCTTCCTTAGAACAGTGCTGG - Intronic
1083795991 11:65017017-65017039 GACCTTGGTAAGGACAGTTTTGG + Intronic
1085951416 11:81337057-81337079 GATCTGGCTAAGAACAGTTAGGG - Intergenic
1086142243 11:83512144-83512166 GAACTAGCAAAGCACAGTTCAGG + Intronic
1091871379 12:3893987-3894009 GACCTTGATAAGAACAGTTTTGG - Intergenic
1094110501 12:26856856-26856878 GAGCTTGCCAAGAACAGTTTTGG + Intergenic
1099647219 12:85373627-85373649 AAGCTTAATAAGTACAGTTTCGG - Intergenic
1106167724 13:27263456-27263478 GAGCTTGTTAAATAGAGTGCTGG - Intergenic
1106245471 13:27946047-27946069 GAGCTTATTAAGTACGCTTCCGG - Intergenic
1112254655 13:97818646-97818668 GAGCATGCTGGGTTCAGTTCTGG - Intergenic
1116417175 14:44692893-44692915 CAGTTTGCTAAGTAAATTTCAGG + Intergenic
1119459898 14:74792390-74792412 GAGCATGCTAAGTAAAGCTAAGG - Intronic
1121257145 14:92539365-92539387 GAGTTTGCTATGAAGAGTTCAGG - Intronic
1122476354 14:102012530-102012552 GTGCTAGCTAAGTGCAGCTCTGG + Intronic
1126324158 15:47457476-47457498 GAGCATGCTAAGCACAGATATGG + Intronic
1126955478 15:53928722-53928744 GAGCTTTCTAAGTGCATTTCTGG + Intergenic
1130603478 15:85294213-85294235 CAGCTTTCTGAGTACATTTCAGG - Intergenic
1131285323 15:91052174-91052196 CAGCTTCCTGAGTACATTTCAGG + Intergenic
1131308827 15:91269366-91269388 GAGCTTGCTAAGTACAGTTCAGG - Intronic
1134608979 16:15592823-15592845 CATCTTGCTAAGGAAAGTTCTGG + Intronic
1139213082 16:65100217-65100239 GAGTTTGCTAAGTGAAGTTTGGG + Intronic
1140395147 16:74620059-74620081 GTTCCTGCTCAGTACAGTTCTGG - Intergenic
1143745952 17:8994363-8994385 GAGTTTGCTACTCACAGTTCCGG + Intergenic
1149069710 17:52525400-52525422 GAGCTTGCTTTGCACAGTGCAGG - Intergenic
1151344193 17:73491807-73491829 GCGCTTCCTTAGCACAGTTCTGG - Intronic
1152475219 17:80513501-80513523 GACCTTGCTAAGTGCAGGTTGGG - Intergenic
937842496 2:126537770-126537792 GGGCTTGCTGAGGACAGTTAGGG - Intergenic
940853588 2:158711329-158711351 GTGCTTTCTAAATACAGTTGTGG + Intergenic
942673699 2:178404454-178404476 TAGCTTGCTAAGTACAGAATTGG + Intergenic
945423477 2:209668681-209668703 GATTTTGCTACGTACAGGTCTGG + Intronic
945619400 2:212114281-212114303 GTGCTGGCTAAGTTCTGTTCTGG - Intronic
945775748 2:214104159-214104181 GGGCTTTCTAAGCAGAGTTCTGG - Intronic
946550618 2:220797832-220797854 AAGCCTGCTAGCTACAGTTCAGG - Intergenic
1173078959 20:39847820-39847842 GAGGTTGCTAAGTATAATTTGGG - Intergenic
1181013955 22:20057626-20057648 GAGCTTGCAAAGGATTGTTCTGG + Intronic
950958857 3:17083286-17083308 GAGCTAGCTACGTGCATTTCTGG + Intronic
953829320 3:46281879-46281901 GAGTTTGCTAACTTCAGATCAGG + Intergenic
954499284 3:50995673-50995695 GAGATTGGTGAGAACAGTTCAGG + Intronic
956793507 3:72698458-72698480 GAGCTTGTGAAGTACAGATAGGG - Intergenic
959077232 3:101761716-101761738 GAGTTTGCTAATTATAATTCAGG + Intronic
959653365 3:108773180-108773202 GAGTTTCCTAAGGACAGTGCAGG - Intergenic
961533739 3:127556628-127556650 GAGCTGACTAAGCACAGTCCGGG + Intergenic
962083358 3:132164369-132164391 GAGCATGCTAAGAATAATTCAGG + Intronic
966009753 3:175060162-175060184 CAGCTTGCTAAATACAGTTGGGG - Intronic
966009951 3:175062799-175062821 GTGCTTGCTAAATACAATTAGGG - Intronic
976450485 4:85184784-85184806 GAGATTGCTATGTTCAGTTTTGG + Intergenic
985138143 4:186810589-186810611 GAACTTTCAAAGTACAGATCTGG - Intergenic
994294185 5:98069154-98069176 GAGCGTGCAAAGTACACTTATGG + Intergenic
996150616 5:120030038-120030060 AGGCTTGCTGAGCACAGTTCTGG - Intergenic
1000290133 5:159862391-159862413 GAGATTGCTAGATGCAGTTCAGG + Intergenic
1005156328 6:22811012-22811034 GAGCTTGCTCCATTCAGTTCTGG + Intergenic
1013727109 6:113112459-113112481 GAGATTGCTGAGAACAGTACTGG - Intergenic
1014009876 6:116462943-116462965 GAGCTTTCTAAGTCCAGTGGTGG - Intronic
1014210835 6:118706434-118706456 AAGCTTGCCAATTCCAGTTCTGG - Intronic
1015029389 6:128575885-128575907 GATCTTGCTAATAAGAGTTCTGG - Intergenic
1018331294 6:162730086-162730108 GTGTTTGCTAAGCACAGTTCTGG + Intronic
1021091713 7:16490791-16490813 GACCTTGCCTAGTTCAGTTCTGG - Intronic
1021194662 7:17662146-17662168 GAGGTTGCTAACCACAGTTGAGG - Intergenic
1030023063 7:105294321-105294343 TACCTTGCTAAATACAGTGCTGG - Intronic
1033435677 7:141331528-141331550 GAGCTTGATAAGAAGAGTTTAGG + Intronic
1039094372 8:33867614-33867636 AAGGCTCCTAAGTACAGTTCAGG + Intergenic
1040306878 8:46216587-46216609 CAGCATGCTAAGGACAGTCCTGG - Intergenic
1052201987 9:25793476-25793498 GAGATTCCTAAGAACAGTTGAGG - Intergenic
1055074068 9:72195827-72195849 GAGCATGCTATGTGCAGTACTGG + Intronic
1055445485 9:76377955-76377977 GAGCTTGCTATGGAGAGTCCAGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1186473091 X:9836370-9836392 GAGGTTTCTAAGAACATTTCTGG + Intronic
1192722531 X:73714425-73714447 GAGATTGCTACCTACAGTTGAGG + Intergenic
1196703435 X:118696271-118696293 GAGCCAGCTGAATACAGTTCAGG + Intergenic