ID: 1131310502

View in Genome Browser
Species Human (GRCh38)
Location 15:91286188-91286210
Sequence CTGTGACATTGGCAAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131310500_1131310502 -4 Left 1131310500 15:91286169-91286191 CCTACATGCAGTGGGTCGGCTGT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG 0: 1
1: 0
2: 2
3: 32
4: 252
1131310496_1131310502 17 Left 1131310496 15:91286148-91286170 CCTTCAATCTTTAGTAAAAGGCC 0: 1
1: 0
2: 2
3: 14
4: 193
Right 1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG 0: 1
1: 0
2: 2
3: 32
4: 252
1131310495_1131310502 18 Left 1131310495 15:91286147-91286169 CCCTTCAATCTTTAGTAAAAGGC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG 0: 1
1: 0
2: 2
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131310502 Original CRISPR CTGTGACATTGGCAAGTGCA TGG Intronic
901071190 1:6519549-6519571 CTGTGGCATTGGCATGTGGCTGG - Intronic
901381188 1:8875705-8875727 CTGTGAAATTGGAAAGTCCCAGG - Intronic
902952023 1:19892373-19892395 CTGTGAGATTCTCAAGGGCAGGG + Intronic
904210765 1:28885582-28885604 GTGTGATATAGGCAAGTGAAAGG + Intergenic
904263915 1:29306906-29306928 CTGGGACCTTGGCAAGACCAAGG - Intronic
905452413 1:38065122-38065144 CTGTGAGATTGGCATTGGCAAGG - Intergenic
906370925 1:45253139-45253161 GTTTGACATTGGAAAGTGCCTGG - Intronic
906647702 1:47487788-47487810 CTGTCACAATGGGGAGTGCAGGG - Intergenic
906833560 1:49059616-49059638 CTGTGACTTTTCCAGGTGCATGG - Intronic
906886090 1:49650645-49650667 CTCTGACTTTGGCAACTACAGGG + Intronic
907414564 1:54305268-54305290 CAGTGATATTGGGAAGGGCAGGG - Intronic
908094414 1:60721792-60721814 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
908305479 1:62810545-62810567 TCGTGACATTGGCCAGTGGAAGG + Intronic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
912194131 1:107377855-107377877 CTGTGAAATAGCCAAGTGCAGGG - Intronic
913533482 1:119749634-119749656 CTGGGATATTGGCAGGTGCTAGG - Intronic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
918049144 1:180959345-180959367 CTGTGACTTTTCCAGGTGCATGG + Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920747546 1:208643357-208643379 CTGTGAAATTGTAAAGTGAAGGG - Intergenic
921892847 1:220370380-220370402 CTGAGCCAGTGGCAAGTGCTAGG + Intergenic
923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG + Intergenic
924766768 1:247039761-247039783 CTGTCTCATTGGCAGGTGCAGGG + Intronic
1063123046 10:3118062-3118084 ATGTGACATTGGTGAGAGCATGG + Intronic
1065348638 10:24774334-24774356 CTGAGACATTGGGAGGAGCAGGG + Intergenic
1068288246 10:54967429-54967451 CTGTTACATTGGCAAAAGAAAGG - Intronic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069121969 10:64577886-64577908 CTGTGACATTGGGAAGGGCGTGG + Intergenic
1069381043 10:67843425-67843447 CTGTGACTTTTCCAGGTGCAGGG - Intergenic
1070191086 10:74112591-74112613 CTGCCACATAGCCAAGTGCAGGG - Intronic
1073152007 10:101318411-101318433 CTCTCAAATTGGCCAGTGCAGGG - Intergenic
1073693917 10:105844276-105844298 CTGAGCCATTGGCAGGTGCCTGG - Intergenic
1075026308 10:118986617-118986639 CTGTGACATCAGCAACTGAAAGG + Intergenic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1077543086 11:3156856-3156878 CTGTGAAATGGGCCATTGCAGGG - Intronic
1077684576 11:4279171-4279193 CTGTGAGATTTGCCAGTGCCTGG + Intergenic
1079596613 11:22257601-22257623 CTGTGATATTGACTAGTGCTTGG + Intronic
1080817479 11:35772410-35772432 CTGTGACTTTTCCAAGTGCATGG - Intronic
1081157829 11:39716446-39716468 CTGTGACTTTTCCAGGTGCACGG - Intergenic
1081262339 11:40976176-40976198 CTGTGAGAAAGCCAAGTGCAAGG - Intronic
1082940790 11:58703365-58703387 CTCTGACTTTGGCAAGCACAGGG + Intronic
1083793631 11:65001943-65001965 AGGTGAGATTGGCAAGGGCAGGG + Intergenic
1084740253 11:71134825-71134847 CTGGGACCCTGGGAAGTGCAGGG - Intronic
1085106133 11:73844600-73844622 CTGTGACATCAGCCAATGCAAGG - Intronic
1085174121 11:74471853-74471875 CTGAGACATAGGAAAGTGAAAGG - Intergenic
1086133588 11:83424575-83424597 ATGTCACATTGGCAAAGGCAGGG + Intergenic
1087900946 11:103640054-103640076 CTGTAGCATTTGGAAGTGCATGG + Intergenic
1091763539 12:3103650-3103672 CTGTGACTTTGGGAAGTGGCTGG + Intronic
1092183729 12:6463406-6463428 CCCTGTCTTTGGCAAGTGCACGG + Intronic
1092949753 12:13490540-13490562 ATGTGCCATTGGCCAGAGCAAGG - Intergenic
1093624286 12:21327445-21327467 CTGTGGCTTTTCCAAGTGCATGG - Intronic
1094101287 12:26766801-26766823 CTGTGACATTTAAAAGTGAAAGG - Intronic
1094422035 12:30280794-30280816 CTGTGACTTTTCCAGGTGCATGG - Intergenic
1097955754 12:65483891-65483913 CTGTGACTTTTCCAGGTGCATGG + Intronic
1098628315 12:72699618-72699640 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
1099952701 12:89322280-89322302 CTGACACATTAGCAAGTGCTCGG + Intergenic
1100164498 12:91901133-91901155 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1103955777 12:124575993-124576015 ATGTGACAAGGGCAGGTGCAGGG + Intergenic
1109364805 13:61340481-61340503 CTGTGACTTTGGCTTGTGAAAGG - Intergenic
1109532579 13:63669975-63669997 CTGTGCCATTTGCAACAGCATGG + Intergenic
1110083344 13:71345550-71345572 CTGTGACTTTTCCAGGTGCATGG + Intergenic
1110757651 13:79194891-79194913 CTAGGACAGTGGAAAGTGCAGGG - Intergenic
1110985039 13:81956562-81956584 CTCTGACTTTGGCAAGCACAGGG + Intergenic
1111221365 13:85208806-85208828 CTGTGGCATTTCCAGGTGCATGG - Intergenic
1112882396 13:104123578-104123600 CTGTGACTTTTCCAGGTGCATGG - Intergenic
1113896298 13:113766434-113766456 CTGGGACAGTGGCAGGTCCAAGG + Intronic
1114146668 14:19985398-19985420 CTCTGACTTTGGCAAGCACAGGG + Intergenic
1114689089 14:24563638-24563660 CTGTGGCTTTTTCAAGTGCAGGG - Intergenic
1116304734 14:43237395-43237417 ATGTGACTTTGGAAAGTCCAAGG + Intergenic
1116316934 14:43409052-43409074 ATGTGTCATTGGCAAGAGGACGG + Intergenic
1118869852 14:69732220-69732242 ATGTGACCTTGGCAAGTCCTTGG - Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1120134894 14:80856221-80856243 CTGTGGGATAGGCAAGGGCATGG - Intronic
1121642382 14:95494440-95494462 CTGGGAGATGGGGAAGTGCAAGG + Intergenic
1126813113 15:52428689-52428711 CTGTGATATTGGAAGGTGCTAGG - Intronic
1127796186 15:62440428-62440450 CTGTGAACTTGGCAAGAGCACGG + Intronic
1127814416 15:62594730-62594752 CTGTGACATTGGTCTGGGCAAGG + Intronic
1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG + Intronic
1129228654 15:74184420-74184442 CTCTGACATGGGTAAGTGCTCGG + Intronic
1131130786 15:89898970-89898992 CTGTGGCATAGGCATCTGCATGG - Exonic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131427077 15:92354449-92354471 CTGTGACTTTTCCAGGTGCACGG - Intergenic
1131723867 15:95201744-95201766 CTGTGGCTTTTGCAGGTGCAAGG - Intergenic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1132941860 16:2512514-2512536 CAGTGACCTTGGCAAGGGCAAGG + Intronic
1133396422 16:5450900-5450922 CTGTGACCTGGGCAAGCTCAAGG + Intergenic
1133649663 16:7799783-7799805 CTTTGAGATTGGCAAGTACAGGG - Intergenic
1134136387 16:11679239-11679261 CGCTGACATTGGCAGGTGGAGGG + Exonic
1136453669 16:30369041-30369063 CTGTGACATTGGCATGTTAGTGG - Intronic
1138874098 16:60928285-60928307 ATGTGACATTAGGTAGTGCAAGG + Intergenic
1140410857 16:74739611-74739633 AAGCGACATTGGCCAGTGCAGGG - Intronic
1141712599 16:85708652-85708674 CTGTGACCTTTCCAAGTGCCTGG - Intronic
1148027698 17:44600001-44600023 CTGGGCCATTGGCAAGTGCGAGG - Intergenic
1148393798 17:47292486-47292508 CAGTGACTTTGGCAAGATCACGG + Exonic
1152142945 17:78549172-78549194 CAGGGACCTTGGCAAGTGCTTGG + Intronic
1154463788 18:14622970-14622992 CTCTGACTTTGGCAAGCACAGGG + Intergenic
1156251062 18:35352882-35352904 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
1157717359 18:49897203-49897225 CTGTGACACCTGCAGGTGCAAGG - Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1159996582 18:74970712-74970734 CTGTGGCATTTCCAGGTGCACGG + Intronic
1160352105 18:78192332-78192354 CTGTGAAATGCTCAAGTGCAGGG - Intergenic
1161761089 19:6173216-6173238 CTGTGACTTTGGCAAGCACAAGG - Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162848305 19:13411271-13411293 CTATCACATGGGCAAGTGAAAGG - Intronic
1167423500 19:49417302-49417324 GTCTGACATTGGGAAGAGCAGGG + Intronic
925766993 2:7245779-7245801 CTGGGACACTGACAAGGGCAAGG + Intergenic
926334325 2:11851826-11851848 CTGTGACTTGGGCAAGAGCTGGG + Intergenic
926519962 2:13897962-13897984 CTGTGACTTTTCCAGGTGCATGG - Intergenic
928412767 2:31067176-31067198 TTGTCACATAGGCAAGGGCAGGG + Intronic
928797570 2:35040591-35040613 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
929630035 2:43450337-43450359 CTGTGACATCGGTAACTGAAAGG + Intronic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
933102864 2:78282386-78282408 CTGTGACTTTTCCAGGTGCATGG - Intergenic
933798659 2:85942309-85942331 CTGTGACTTTTCCAGGTGCACGG + Intergenic
933861265 2:86471095-86471117 CTGTGTCCTTGACAACTGCAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935577986 2:104730551-104730573 TAGTAACATTGACAAGTGCAAGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938391435 2:130909705-130909727 CTGTGACACTGCCAAATGCAAGG - Intronic
940100722 2:150035475-150035497 CTCTGACTTTGGCAAGGCCAGGG + Intergenic
940381302 2:153017946-153017968 CTGTGACTTTTCCAGGTGCATGG + Intergenic
941099731 2:161282430-161282452 GTGTGACAGTAGCAAGTGGATGG - Intergenic
941967706 2:171315946-171315968 CAGTGTCATTGGCAAGTGCCTGG - Intergenic
943238077 2:185347985-185348007 CTGTGACTTTTCCAGGTGCATGG - Intergenic
943569466 2:189556112-189556134 TGGTGACATTTGCAAGTGAATGG - Intergenic
943852014 2:192735617-192735639 CTGGGACATTATCAAGTGAAAGG - Intergenic
944862164 2:203825419-203825441 CTGTAACCTTAGCAAGAGCAAGG + Intergenic
946021173 2:216641148-216641170 CTGTGATAATGGCAAGTACCTGG + Intronic
947829617 2:233129739-233129761 CCGTGAAATTGCAAAGTGCATGG + Intronic
948888574 2:240896213-240896235 CTGTGACATTCCCAATTGCTGGG - Intronic
1169988221 20:11470602-11470624 CAGTCACATTGCCAAGGGCATGG - Intergenic
1170065242 20:12303535-12303557 CTGTGACTTTTGCAGGTGCATGG + Intergenic
1173942892 20:46927021-46927043 CTGTGTCATGGGCAAGGACATGG + Intronic
1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG + Intergenic
1175868044 20:62191861-62191883 CTGTGCCCTTGGCACCTGCAAGG + Intronic
1176810744 21:13535404-13535426 CTCTGACTTTGGCAAGCACAGGG - Intergenic
1179185920 21:39085192-39085214 CTGTGACCAGGACAAGTGCATGG - Intergenic
1179398403 21:41061896-41061918 CAGTGGACTTGGCAAGTGCACGG - Intergenic
1181015028 22:20063801-20063823 CTGGCCCATTGGCAGGTGCAGGG + Intronic
1184590230 22:45477100-45477122 ATCTGACATTGCCAAGTGCAGGG + Intergenic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
949832031 3:8225282-8225304 TTGTGACACTGGCATATGCAAGG - Intergenic
951500145 3:23376879-23376901 ATGTGACATTCGCAAGGGGAGGG + Intronic
952512076 3:34068033-34068055 CTGGGACAATGGCAAGGACAAGG + Intergenic
953538100 3:43791087-43791109 CTCTGACATTTGCAACTGGATGG - Intergenic
954273132 3:49524841-49524863 CTGGGACATAGGCACGTGCCCGG - Intronic
954332290 3:49897477-49897499 CTGTGCCCTTGGCCAGTGCATGG - Intronic
955682274 3:61514692-61514714 CAGTAACCTTGGCAAGTTCATGG - Intergenic
955849350 3:63203469-63203491 CTGTGGCATTGGCAGATTCAAGG - Intergenic
956260554 3:67335976-67335998 CTCTGACTTTGGCAAGCACAAGG + Intergenic
963575632 3:147058499-147058521 CTCTGACTTTGGCAAGCACAGGG + Intergenic
964545386 3:157828442-157828464 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
965264993 3:166531732-166531754 CTGTGACTTTTCCAGGTGCAAGG + Intergenic
968491678 4:893545-893567 CTGTGACCTCTGCCAGTGCAGGG - Intronic
969152057 4:5177943-5177965 CTGTGACTTTTCCAGGTGCATGG + Intronic
969657097 4:8504726-8504748 TTGTGACAGGGGCAAGAGCAAGG - Intergenic
970361299 4:15311129-15311151 CTGTGGCATTTCCATGTGCACGG - Intergenic
974058623 4:57009577-57009599 CTGTGACATTGGGAAGGGAGGGG + Intronic
976370109 4:84278332-84278354 GTGTGACTTTGGAAGGTGCATGG - Intergenic
976391410 4:84508578-84508600 ATGTGATATTGGCAAGAGAAGGG + Intergenic
977053689 4:92162807-92162829 CTCTGACTTTGGCAAGCACAGGG + Intergenic
977202171 4:94130202-94130224 CTGTGACATTGGGAATGGGAGGG + Intergenic
978777174 4:112515877-112515899 CTGTGACTTTGGCCTGTGCCGGG + Exonic
981451399 4:144901700-144901722 CTGTGAAATTTGCAACTGCTGGG - Intergenic
982749461 4:159142388-159142410 CTAGTACATTGGCAAGTGGATGG + Intronic
983156839 4:164358299-164358321 CAGTGACATTGGCAAGTTCAAGG - Intronic
984511609 4:180685376-180685398 CTGTGAAATCGGCAAATTCAGGG - Intergenic
985173849 4:187179858-187179880 CTGTAACATTGGAAGCTGCAAGG + Intergenic
985201469 4:187489110-187489132 CTGTGACTTTTCCAGGTGCATGG - Intergenic
985337663 4:188913831-188913853 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
985617731 5:934129-934151 CTGTGACTTTTCCAGGTGCATGG + Intergenic
985790838 5:1926249-1926271 CTGTGGCATTGGCAGGGGCTGGG - Intergenic
985955292 5:3261278-3261300 ATGGCACATTGGCAGGTGCAAGG + Intergenic
986050574 5:4086279-4086301 CTCTGGCTTTGACAAGTGCAGGG + Intergenic
986745117 5:10736945-10736967 CTCTGCCTTTGGCCAGTGCAGGG + Intronic
988928880 5:36016056-36016078 CTGTGGCATTTCCAAGTACAGGG - Intergenic
989717773 5:44484191-44484213 CTATGATCTTGGCAAGTGAAAGG - Intergenic
989763166 5:45045603-45045625 CAGTGACATTGGGAGATGCATGG + Intergenic
991776397 5:70089747-70089769 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
991855684 5:70965194-70965216 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
991869698 5:71097972-71097994 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
993505915 5:88708347-88708369 CTGTGAGGTTGGGAGGTGCAGGG + Intergenic
993582357 5:89677998-89678020 CTCTGACTTTGGAAAGGGCAGGG + Intergenic
994691401 5:103024357-103024379 CTGTAACATTGGCAGGTACTGGG - Intronic
996324650 5:122258885-122258907 CTCTGACATTAGCCACTGCAGGG - Intergenic
996753161 5:126909636-126909658 GTGAGGCATTGGGAAGTGCAAGG - Intronic
997041573 5:130262118-130262140 CTGTGATATTGGCAAAAGAATGG - Intergenic
997078223 5:130706501-130706523 CTTTTACATTGGCTAGGGCACGG - Intergenic
997838078 5:137212781-137212803 CTCTGACATTGTCTACTGCAAGG - Intronic
998399952 5:141843458-141843480 GTGTGTCCTTGGCAAGGGCAAGG - Intergenic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999284178 5:150384201-150384223 CTGTGCCATTGGAAAGTGAGAGG - Intronic
999582585 5:153055777-153055799 CTGTGGCTTTGTCAGGTGCAAGG + Intergenic
999770315 5:154770556-154770578 CTGAGACACAGGCAAGGGCATGG + Intronic
1001278129 5:170365749-170365771 GTGTGACCTTGGGAAGTCCAAGG + Intronic
1001311702 5:170615643-170615665 CTGTTACCATGGCAAGTGGAGGG - Intronic
1003094533 6:3131931-3131953 CCGTGACACAGGCACGTGCAAGG - Intronic
1006581989 6:35082575-35082597 CAGTGACCTTAGCAAGTTCAAGG - Intronic
1006901983 6:37508563-37508585 CTGTGAGAGAGGCAAGTGTAAGG + Intergenic
1008499823 6:52169887-52169909 CTGTGGCTTTTCCAAGTGCAAGG + Intergenic
1011311782 6:85987900-85987922 CTGCGACATTGACAACTACATGG + Intergenic
1011628587 6:89302949-89302971 CTGGTACATGGGCAAGGGCATGG + Intronic
1012224190 6:96686235-96686257 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1014747139 6:125213724-125213746 CTGTAACCTTGGCAGGTCCAGGG - Intronic
1016438204 6:144059200-144059222 CTGTGGCTTTGGGGAGTGCAAGG - Intronic
1017125469 6:151060422-151060444 CTGTGAACTCTGCAAGTGCAAGG - Intronic
1017182053 6:151563495-151563517 TTCTGACTTTGGCAGGTGCAGGG - Intronic
1017304355 6:152899158-152899180 CTGGCACATGGGCAAGAGCATGG + Intergenic
1019327410 7:445274-445296 CTCTGACCATGGCATGTGCAGGG - Intergenic
1020878219 7:13725265-13725287 CTGTCAGAGTGACAAGTGCAGGG + Intergenic
1022574377 7:31483265-31483287 CCTTGGCATTGGCTAGTGCAGGG + Intergenic
1022641565 7:32190271-32190293 CTGTGAAATGTGCAAGTCCAGGG - Intronic
1025573392 7:62603517-62603539 GTGTGACATAGGCATGGGCAAGG - Intergenic
1026555355 7:71403856-71403878 CTGTGACTTTGGCTATTTCAAGG + Intronic
1028054142 7:86222565-86222587 CTGTGGCTTTTGCAGGTGCATGG + Intergenic
1028163388 7:87510721-87510743 TTGTGACACTGGCAGGTGCAGGG + Intronic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1031247070 7:119327510-119327532 CTGTGACTTTGGCAACAGGATGG - Intergenic
1031573149 7:123383728-123383750 CTGTGACTTTTCCAGGTGCATGG - Intergenic
1033234763 7:139629556-139629578 ATGTGACCATGGCAAGTGCCTGG - Intronic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1034573095 7:151972991-151973013 CTGTGTCTTTTCCAAGTGCATGG - Intronic
1036178910 8:6566664-6566686 CTGTGTGATTGGCAAGGCCATGG + Intronic
1036644873 8:10606755-10606777 CTGTGTCCTTGGCAAGTCCTTGG + Exonic
1038880425 8:31605195-31605217 GTGTGGCATTGCCAGGTGCATGG + Intergenic
1039681856 8:39747912-39747934 CTTTGAAATTGGATAGTGCATGG - Intronic
1041108334 8:54462614-54462636 CTGTGACATTACCAAGTGCCTGG + Intergenic
1042021249 8:64372750-64372772 CTGTGACCTTGACATGTGAAAGG + Intergenic
1042725241 8:71868207-71868229 CTGTGACACTGGCTGGAGCAGGG + Intronic
1044835048 8:96287613-96287635 GAGTGACATTGACAGGTGCAGGG - Intronic
1044840822 8:96335563-96335585 CTGTGGCATTGTGAAGAGCAGGG + Exonic
1045040602 8:98220262-98220284 GTGTGACATTGGCATTTACAGGG - Intronic
1045681268 8:104662965-104662987 CTGAGGGATTGGCAAGGGCAAGG + Intronic
1046181515 8:110655480-110655502 CTCTGATTTTGGCAAGCGCAAGG + Intergenic
1046769596 8:118105161-118105183 CTGTGACATTGGCATATTAAAGG + Intronic
1048024719 8:130575599-130575621 CTGTGGCTTTGGCAACTGCAAGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049515262 8:143051135-143051157 CAGTGACATTGGGAAATGCAAGG + Intronic
1050881538 9:10706010-10706032 GTGTGACATTCCCAAGAGCAAGG - Intergenic
1050928995 9:11300928-11300950 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
1052637222 9:31121250-31121272 CTGTGACTTTTCCAGGTGCACGG + Intergenic
1053469455 9:38335813-38335835 CTGTGACCTTGGAAACTGCTTGG + Intergenic
1055908174 9:81317471-81317493 CAGAGGCAATGGCAAGTGCAGGG - Intergenic
1056933389 9:90897126-90897148 CTGAGACATTTTAAAGTGCATGG + Exonic
1058838347 9:108879929-108879951 CTGTGCCATGGGCAAGTGTGAGG - Intronic
1059043985 9:110844186-110844208 CTGAGAAATTGGCCAGGGCAAGG + Intergenic
1059110709 9:111556322-111556344 CTGTGACTTTTCCAGGTGCATGG + Intronic
1059147608 9:111914996-111915018 CTCAGACATTGTCAAGTGCCTGG + Intronic
1059355352 9:113694951-113694973 CGCTGACATTGGCAGGGGCAGGG + Intergenic
1060031655 9:120219516-120219538 CTGGGACATTTGAGAGTGCAGGG - Intergenic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1060487019 9:124054290-124054312 CTGTGCAATGGGCTAGTGCATGG + Intergenic
1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG + Intergenic
1203666387 Un_KI270754v1:22845-22867 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203667537 Un_KI270754v1:28484-28506 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203668685 Un_KI270754v1:34123-34145 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1189665533 X:43350925-43350947 CTCTGACTTTGGCAAGTACAGGG - Intergenic
1190750232 X:53355914-53355936 CTGTGACATTGTGCAGTGGATGG - Intergenic
1192689728 X:73349600-73349622 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1192737168 X:73860827-73860849 CTACAACATTGGCAACTGCATGG + Intergenic
1193183244 X:78483239-78483261 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
1193726887 X:85051487-85051509 TTGTTACATTGGCTGGTGCAAGG + Exonic
1193795334 X:85866610-85866632 CTGTGACTTTTCCAGGTGCATGG - Intronic
1193934814 X:87604835-87604857 CTGTGACATTGGGAGGGGCAAGG - Intronic
1194207795 X:91032571-91032593 CTATGACACTGGCAAGTATAGGG + Intergenic
1194369834 X:93058987-93059009 CTCTGACTTTGGCAAGCACAGGG + Intergenic
1194522527 X:94936176-94936198 CTGTAACTTTTGCAGGTGCATGG - Intergenic
1194841679 X:98751945-98751967 CTGTGACTTTTCCAGGTGCATGG + Intergenic
1194952676 X:100145363-100145385 CTGTGGCATTTCCAGGTGCACGG - Intergenic
1195543754 X:106092011-106092033 TTGTGACTTTGAGAAGTGCAAGG + Intergenic
1196037676 X:111164582-111164604 CTGTGAGATTCTCAAGAGCAGGG + Intronic
1196996321 X:121388025-121388047 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1197073303 X:122326134-122326156 CTCTGACTTTGGCAAGAACAGGG + Intergenic
1197302007 X:124792358-124792380 CTGTGACATTGGCATGTTTAAGG - Intronic
1197433794 X:126400317-126400339 CTGTGACATTGGAAACTGCATGG + Intergenic
1198735036 X:139775930-139775952 CTCTGACTTTGGCAAGCTCATGG + Intronic
1199027845 X:142960959-142960981 CTGTGACTTTTCCAGGTGCAGGG + Intergenic
1199362848 X:146943176-146943198 CTGTGACTTTTCCAGGTGCATGG + Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1200678021 Y:6175197-6175219 CTCTGACTTTGGCAAGCACAGGG + Intergenic
1201144985 Y:11059510-11059532 CTGGGACCCTGGGAAGTGCAGGG - Intergenic