ID: 1131310753

View in Genome Browser
Species Human (GRCh38)
Location 15:91287916-91287938
Sequence GCCGTGGAGCAAGAGCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131310752_1131310753 -9 Left 1131310752 15:91287902-91287924 CCATGGGGGCTGGAGCCGTGGAG 0: 1
1: 0
2: 1
3: 36
4: 304
Right 1131310753 15:91287916-91287938 GCCGTGGAGCAAGAGCTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131310753 Original CRISPR GCCGTGGAGCAAGAGCTACC TGG Intronic
900014362 1:138120-138142 GCAGTGAAGCAACAGCTAGCTGG + Intergenic
900044227 1:493322-493344 GCAGTGAAGCAACAGCTAGCTGG + Intergenic
900065635 1:728228-728250 GCAGTGAAGCAACAGCTAGCTGG + Intergenic
900462384 1:2807849-2807871 GCCCTGGAGCAGGACCTGCCCGG - Intergenic
900614942 1:3561240-3561262 GCTGAGGAGCAAGGGCTACGGGG + Intronic
901613857 1:10521354-10521376 CCCGTGGAGGCAGAGCTATCTGG + Intronic
901751715 1:11413981-11414003 GCATTGGAGCAAGAGATACAAGG - Intergenic
902978974 1:20109585-20109607 GCCCTGGAGCCAGAGATACCTGG + Intergenic
904236197 1:29118908-29118930 GGCCTGTAGGAAGAGCTACCAGG + Exonic
906642621 1:47450487-47450509 GCTGCGGCGCAAGAGCTACAGGG - Intergenic
906953959 1:50357374-50357396 GGCGTTGAGCAAGAGCGAGCTGG - Intergenic
912841547 1:113043659-113043681 GCTGTGGAGTAAGAGTTCCCTGG - Intergenic
914257880 1:145975364-145975386 GCACTGAAGCAAGAGCTACGAGG + Exonic
915141449 1:153771012-153771034 GGCGGGGAGCAGGAGCCACCAGG - Intronic
915784664 1:158596941-158596963 GCCAGGAAGCAAGTGCTACCAGG + Intergenic
919192902 1:194246682-194246704 GCTGTGGAGCAAGTGGGACCTGG - Intergenic
919816130 1:201440972-201440994 CCTGTGGAGAAAGAGCTAACAGG + Intergenic
922208939 1:223472303-223472325 GGGGTGGAGCAAGGGCTCCCAGG - Intergenic
923156317 1:231282336-231282358 GACGTGGAGGAGGAGCTGCCTGG + Intergenic
1069852939 10:71422299-71422321 TCTTTGGAGCCAGAGCTACCTGG + Intronic
1071528739 10:86373418-86373440 GGCTTGGAGCAAGGGCTGCCTGG + Intergenic
1072742360 10:97917190-97917212 GCAGTGGGGCAAGAGGTTCCAGG + Intronic
1074993249 10:118731135-118731157 GCCGTGAAGCAACTGTTACCTGG - Intronic
1076970559 11:129797-129819 GCAGTGAAGCAACAGCTAGCTGG + Intergenic
1077265836 11:1649201-1649223 GCCGTGGAGCACCTGCCACCTGG - Intergenic
1079093249 11:17495094-17495116 ATGGTGGAGCAAGAGCTCCCAGG + Intronic
1083694477 11:64433491-64433513 GCCATGGTGCGAGAGCTGCCAGG + Intergenic
1085503270 11:77041076-77041098 GCAGTGGAGCAAGGGAGACCTGG + Exonic
1089622344 11:119729066-119729088 GCCGCGCAGCCAGAGCCACCCGG - Exonic
1090977264 11:131688585-131688607 GCCGCAGGGCAAGAGCAACCCGG - Intronic
1095039069 12:37422396-37422418 GAGGTGGAGTAAGGGCTACCTGG - Intergenic
1097988549 12:65809978-65810000 GCCCTGGAGGAGGAGCTACCTGG - Intergenic
1104683843 12:130771512-130771534 GCCGTGGAGCAGGAGCAACTTGG - Intergenic
1105949122 13:25213769-25213791 GCCCTGGAGGATGAGCTGCCAGG - Intergenic
1117185649 14:53237789-53237811 GCCTTGGAGCCAGAGCAACATGG + Intergenic
1122282815 14:100634257-100634279 GCGTTGTTGCAAGAGCTACCTGG + Intergenic
1125728847 15:41881888-41881910 GCGGTGGAGCAAGGGAGACCAGG + Intronic
1126703748 15:51388794-51388816 GCCGAAGAGCAAGAGCGAACAGG + Intronic
1128229463 15:66024706-66024728 GCTCTGAAGCCAGAGCTACCAGG - Intronic
1131116267 15:89797887-89797909 GCCATGGAAAAAGAGCTACATGG + Intronic
1131310753 15:91287916-91287938 GCCGTGGAGCAAGAGCTACCTGG + Intronic
1133046868 16:3092891-3092913 GCCGTGGAGCAGGAGCAGCTGGG - Intronic
1142457399 17:64160-64182 GCAGTGAAGCAACAGCTAGCTGG + Intergenic
1142665852 17:1463383-1463405 CCCCTGGAGACAGAGCTACCAGG - Intergenic
1142843255 17:2650582-2650604 GCAGTGGCGCAAGACCTCCCAGG - Intronic
1148793672 17:50187203-50187225 GCCGTGGGGCCAGAGCCAGCAGG - Intronic
1151630523 17:75307973-75307995 GCAGGGGAGCAAGAGCCCCCTGG + Intergenic
1152316202 17:79581835-79581857 GCCATGGAGCTAGAGCCACTTGG + Intergenic
1152363017 17:79841054-79841076 TCCGTGGCGCAAGAGCTGCAAGG - Intergenic
1152772951 17:82181318-82181340 GCCCTGGAGCGAGAGCTCCAAGG - Intronic
1156494435 18:37516707-37516729 GCCTTGGAGCCAGACCTGCCTGG - Intronic
1159006282 18:63015789-63015811 GCCATGGAGCAAGACCTCCCAGG + Intergenic
1160764698 19:802276-802298 GCCCTGGCTCAAGAGCTTCCTGG - Intronic
1161417770 19:4157220-4157242 GTGGTGGAGCAAGAGTTGCCAGG - Exonic
1162116010 19:8429896-8429918 GCCCTGGAGCAAGACTTCCCAGG + Intronic
1165062281 19:33210752-33210774 GGCGTGGAGGCAGGGCTACCCGG - Intronic
1165689926 19:37855392-37855414 GCTGTGGAGCAGGAGCTGCCGGG - Intergenic
1167327239 19:48834322-48834344 GCCCTGGAGCAGGAGCTCCCTGG - Exonic
925284465 2:2706681-2706703 GACGTGGAGCAGGGGCTCCCAGG - Intergenic
925599020 2:5589224-5589246 ACCATGAAGCAAGAACTACCTGG + Intergenic
926240018 2:11078263-11078285 ACAGTGGAGCAGGAGCTGCCTGG + Intergenic
932325189 2:70854713-70854735 TCCCTGGAGCAAGAACCACCAGG + Intergenic
941681013 2:168399659-168399681 GCAGTGGAGAAAGATCTATCAGG - Intergenic
948257986 2:236582476-236582498 GCTGTAAAGCAAAAGCTACCAGG + Intergenic
948994549 2:241571872-241571894 GCCTTGGAGCCTGGGCTACCAGG - Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169355526 20:4901747-4901769 GCCATGAAACAGGAGCTACCCGG - Intronic
1181049782 22:20233058-20233080 GCCGTGGAGCCAGTGCCATCTGG - Intergenic
1181551465 22:23641233-23641255 GCCGTGGAGAAACAGATGCCGGG - Intergenic
1184937921 22:47738737-47738759 GCCCTGAAGCAAGAGTGACCAGG + Intergenic
1185390787 22:50560699-50560721 GCTGTGTGGAAAGAGCTACCTGG + Intronic
954783808 3:53078904-53078926 GCCCTGGAGCAAGAGTGAGCAGG + Intronic
957730264 3:84125477-84125499 GCCGGGTTGCAAGAGCTCCCAGG - Intergenic
969694254 4:8725790-8725812 GCCGTGGAGCAGGGGTTTCCAGG - Intergenic
972941385 4:44198942-44198964 GACATGGAGAAAGAGCTACCAGG + Intronic
974077194 4:57177932-57177954 TCTGTGGAGCAAGAACTACTAGG + Intergenic
975371363 4:73592323-73592345 GCAATGGAGAAAGAGCTGCCAGG - Intronic
977775073 4:100907983-100908005 GCTATGGAGCAAGAGATACTTGG + Intergenic
989576647 5:42993896-42993918 GCCTTGGTGTAAGAGCTCCCAGG - Intergenic
997418942 5:133750790-133750812 GCCATGGAGGGAGAGCTTCCAGG - Intergenic
999186611 5:149715352-149715374 GCCATGGGGCAAGAGATAACTGG + Intergenic
999232333 5:150069146-150069168 GCCTTGGAGCAACTGCTACCAGG - Intronic
1002729616 5:181325607-181325629 GCAGTGAAGCAACAGCTAGCTGG - Intergenic
1002828137 6:792441-792463 GCATTGTAGCAACAGCTACCAGG - Intergenic
1006985570 6:38173377-38173399 GCCCTGCAGCTGGAGCTACCGGG + Exonic
1016695666 6:146992032-146992054 GACGTGGAGTGAGAGCTGCCTGG + Intergenic
1016999707 6:149987892-149987914 GCCCAGGAGCAAGACCAACCTGG - Intergenic
1023936645 7:44745254-44745276 GCCCTGTAGCCACAGCTACCTGG - Intergenic
1024648791 7:51388382-51388404 GCAGTGAGGCAAGAGCTAGCTGG + Intergenic
1025233914 7:57220834-57220856 GCCGTGGAGCTGGAGATCCCGGG + Intergenic
1030528922 7:110687935-110687957 GCCAAAGAGCAAAAGCTACCAGG - Intronic
1032094931 7:128933240-128933262 GCTGTGGAGCATGAGGCACCTGG - Intergenic
1034439154 7:151077708-151077730 GCCGTGGAGCTGGAGCTCCCAGG - Exonic
1035078790 7:156199292-156199314 GCCGTGGAGCAAGGGCTGGGTGG - Intergenic
1038725962 8:30082899-30082921 GCCGAGGAGCAAGCAGTACCCGG + Exonic
1043296224 8:78666333-78666355 GCGGTGGAGCTAACGCTACCAGG + Intronic
1051589346 9:18760504-18760526 GCCATGGAGAAAGGGCTTCCTGG - Intronic
1061177316 9:129005580-129005602 GCTGTGTACCGAGAGCTACCTGG + Intronic
1061418633 9:130461558-130461580 GCCGGGGAGTAGGTGCTACCTGG + Intronic
1062413381 9:136435754-136435776 ACGGTGGTGCAAGAGCCACCAGG + Intronic
1203577586 Un_KI270745v1:20876-20898 GCAGTGAAGCAACAGCTAGCTGG - Intergenic
1189325527 X:40108866-40108888 GCCGAGGAGCCAGAGCGAACCGG - Intronic
1197939818 X:131777943-131777965 CCCTTGGAGCAAGAGTTAGCAGG - Intergenic
1197941133 X:131791815-131791837 CCCTTGGAGCAAGAGTTAGCAGG - Intergenic
1197942231 X:131802538-131802560 CCCTTGGAGCAAGAGTTAGCAGG - Intergenic
1200158623 X:153992481-153992503 GTCATGGTGCAAGAGCTTCCTGG - Intergenic