ID: 1131315565

View in Genome Browser
Species Human (GRCh38)
Location 15:91333790-91333812
Sequence ACTCCCGGCCTCCAGAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131315560_1131315565 0 Left 1131315560 15:91333767-91333789 CCCTGACAACACCTTGATCTTGG No data
Right 1131315565 15:91333790-91333812 ACTCCCGGCCTCCAGAACTGTGG No data
1131315562_1131315565 -1 Left 1131315562 15:91333768-91333790 CCTGACAACACCTTGATCTTGGA No data
Right 1131315565 15:91333790-91333812 ACTCCCGGCCTCCAGAACTGTGG No data
1131315559_1131315565 29 Left 1131315559 15:91333738-91333760 CCAAGGAGAGGGGTCTCAGGAGA No data
Right 1131315565 15:91333790-91333812 ACTCCCGGCCTCCAGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131315565 Original CRISPR ACTCCCGGCCTCCAGAACTG TGG Intergenic