ID: 1131315565 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:91333790-91333812 |
Sequence | ACTCCCGGCCTCCAGAACTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1131315560_1131315565 | 0 | Left | 1131315560 | 15:91333767-91333789 | CCCTGACAACACCTTGATCTTGG | No data | ||
Right | 1131315565 | 15:91333790-91333812 | ACTCCCGGCCTCCAGAACTGTGG | No data | ||||
1131315562_1131315565 | -1 | Left | 1131315562 | 15:91333768-91333790 | CCTGACAACACCTTGATCTTGGA | No data | ||
Right | 1131315565 | 15:91333790-91333812 | ACTCCCGGCCTCCAGAACTGTGG | No data | ||||
1131315559_1131315565 | 29 | Left | 1131315559 | 15:91333738-91333760 | CCAAGGAGAGGGGTCTCAGGAGA | No data | ||
Right | 1131315565 | 15:91333790-91333812 | ACTCCCGGCCTCCAGAACTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1131315565 | Original CRISPR | ACTCCCGGCCTCCAGAACTG TGG | Intergenic | ||