ID: 1131318589

View in Genome Browser
Species Human (GRCh38)
Location 15:91364670-91364692
Sequence TTCCATATCAATAAGCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131318585_1131318589 14 Left 1131318585 15:91364633-91364655 CCACTTTGCAAAGCTAATATACA No data
Right 1131318589 15:91364670-91364692 TTCCATATCAATAAGCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131318589 Original CRISPR TTCCATATCAATAAGCATCA AGG Intergenic
No off target data available for this crispr