ID: 1131329671

View in Genome Browser
Species Human (GRCh38)
Location 15:91485380-91485402
Sequence GTGGTGATGCCTCTGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131329671_1131329677 24 Left 1131329671 15:91485380-91485402 CCCAGCCACAGAGGCATCACCAC No data
Right 1131329677 15:91485427-91485449 GAGAAAGGTTGAGTGATTTGAGG No data
1131329671_1131329676 9 Left 1131329671 15:91485380-91485402 CCCAGCCACAGAGGCATCACCAC No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data
1131329671_1131329674 -8 Left 1131329671 15:91485380-91485402 CCCAGCCACAGAGGCATCACCAC No data
Right 1131329674 15:91485395-91485417 ATCACCACTCTCACTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131329671 Original CRISPR GTGGTGATGCCTCTGTGGCT GGG (reversed) Intergenic
No off target data available for this crispr