ID: 1131329671 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:91485380-91485402 |
Sequence | GTGGTGATGCCTCTGTGGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1131329671_1131329677 | 24 | Left | 1131329671 | 15:91485380-91485402 | CCCAGCCACAGAGGCATCACCAC | No data | ||
Right | 1131329677 | 15:91485427-91485449 | GAGAAAGGTTGAGTGATTTGAGG | No data | ||||
1131329671_1131329676 | 9 | Left | 1131329671 | 15:91485380-91485402 | CCCAGCCACAGAGGCATCACCAC | No data | ||
Right | 1131329676 | 15:91485412-91485434 | ATGAGGAAGCAGAGTGAGAAAGG | No data | ||||
1131329671_1131329674 | -8 | Left | 1131329671 | 15:91485380-91485402 | CCCAGCCACAGAGGCATCACCAC | No data | ||
Right | 1131329674 | 15:91485395-91485417 | ATCACCACTCTCACTAAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1131329671 | Original CRISPR | GTGGTGATGCCTCTGTGGCT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |