ID: 1131329672 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:91485381-91485403 |
| Sequence | AGTGGTGATGCCTCTGTGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131329672_1131329674 | -9 | Left | 1131329672 | 15:91485381-91485403 | CCAGCCACAGAGGCATCACCACT | No data | ||
| Right | 1131329674 | 15:91485395-91485417 | ATCACCACTCTCACTAAATGAGG | No data | ||||
| 1131329672_1131329676 | 8 | Left | 1131329672 | 15:91485381-91485403 | CCAGCCACAGAGGCATCACCACT | No data | ||
| Right | 1131329676 | 15:91485412-91485434 | ATGAGGAAGCAGAGTGAGAAAGG | No data | ||||
| 1131329672_1131329677 | 23 | Left | 1131329672 | 15:91485381-91485403 | CCAGCCACAGAGGCATCACCACT | No data | ||
| Right | 1131329677 | 15:91485427-91485449 | GAGAAAGGTTGAGTGATTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131329672 | Original CRISPR | AGTGGTGATGCCTCTGTGGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||