ID: 1131329673

View in Genome Browser
Species Human (GRCh38)
Location 15:91485385-91485407
Sequence TGAGAGTGGTGATGCCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131329673_1131329677 19 Left 1131329673 15:91485385-91485407 CCACAGAGGCATCACCACTCTCA No data
Right 1131329677 15:91485427-91485449 GAGAAAGGTTGAGTGATTTGAGG No data
1131329673_1131329676 4 Left 1131329673 15:91485385-91485407 CCACAGAGGCATCACCACTCTCA No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131329673 Original CRISPR TGAGAGTGGTGATGCCTCTG TGG (reversed) Intergenic
No off target data available for this crispr