ID: 1131329675

View in Genome Browser
Species Human (GRCh38)
Location 15:91485399-91485421
Sequence GCTTCCTCATTTAGTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131329675_1131329677 5 Left 1131329675 15:91485399-91485421 CCACTCTCACTAAATGAGGAAGC No data
Right 1131329677 15:91485427-91485449 GAGAAAGGTTGAGTGATTTGAGG No data
1131329675_1131329678 26 Left 1131329675 15:91485399-91485421 CCACTCTCACTAAATGAGGAAGC No data
Right 1131329678 15:91485448-91485470 GGAAGAGAACACAAGTAGAGAGG No data
1131329675_1131329679 30 Left 1131329675 15:91485399-91485421 CCACTCTCACTAAATGAGGAAGC No data
Right 1131329679 15:91485452-91485474 GAGAACACAAGTAGAGAGGTAGG No data
1131329675_1131329676 -10 Left 1131329675 15:91485399-91485421 CCACTCTCACTAAATGAGGAAGC No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131329675 Original CRISPR GCTTCCTCATTTAGTGAGAG TGG (reversed) Intergenic
No off target data available for this crispr