ID: 1131329676

View in Genome Browser
Species Human (GRCh38)
Location 15:91485412-91485434
Sequence ATGAGGAAGCAGAGTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131329675_1131329676 -10 Left 1131329675 15:91485399-91485421 CCACTCTCACTAAATGAGGAAGC No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data
1131329668_1131329676 20 Left 1131329668 15:91485369-91485391 CCTCACCATTGCCCAGCCACAGA No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data
1131329671_1131329676 9 Left 1131329671 15:91485380-91485402 CCCAGCCACAGAGGCATCACCAC No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data
1131329670_1131329676 15 Left 1131329670 15:91485374-91485396 CCATTGCCCAGCCACAGAGGCAT No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data
1131329673_1131329676 4 Left 1131329673 15:91485385-91485407 CCACAGAGGCATCACCACTCTCA No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data
1131329672_1131329676 8 Left 1131329672 15:91485381-91485403 CCAGCCACAGAGGCATCACCACT No data
Right 1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131329676 Original CRISPR ATGAGGAAGCAGAGTGAGAA AGG Intergenic
No off target data available for this crispr