ID: 1131330142

View in Genome Browser
Species Human (GRCh38)
Location 15:91490489-91490511
Sequence CATCCATGGTTGTGTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131330142_1131330146 14 Left 1131330142 15:91490489-91490511 CCTGGGGCACACAACCATGGATG No data
Right 1131330146 15:91490526-91490548 TAGGAGACTAAACTATGTTGTGG No data
1131330142_1131330144 -5 Left 1131330142 15:91490489-91490511 CCTGGGGCACACAACCATGGATG No data
Right 1131330144 15:91490507-91490529 GGATGCCATATAAACAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131330142 Original CRISPR CATCCATGGTTGTGTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr