ID: 1131334309

View in Genome Browser
Species Human (GRCh38)
Location 15:91532930-91532952
Sequence ATCAGACATCAGGCAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131334309_1131334316 22 Left 1131334309 15:91532930-91532952 CCCTATTCTGCCTGATGTCTGAT 0: 1
1: 1
2: 0
3: 21
4: 184
Right 1131334316 15:91532975-91532997 CTTCTTAGCTTTCTGATTCTTGG 0: 1
1: 0
2: 2
3: 50
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131334309 Original CRISPR ATCAGACATCAGGCAGAATA GGG (reversed) Intergenic
901258439 1:7853065-7853087 ATCAGTGAGCAGGCAGAATGAGG - Intronic
904763522 1:32822651-32822673 ATCAGACATCAGAAAGAGAATGG + Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
906902229 1:49847466-49847488 AACAGACAACATGCAGAATTGGG + Intronic
907529648 1:55081818-55081840 ATCACAAAGTAGGCAGAATAGGG - Intronic
907666159 1:56435500-56435522 ATGATACATAAGGAAGAATATGG + Intergenic
908979964 1:69943800-69943822 ATCAGATATCAGGAATAAGAGGG + Intronic
909146388 1:71938779-71938801 AACAGCCATCATGCAGAACAGGG + Intronic
910632948 1:89375323-89375345 ATCTCACACCAGTCAGAATAGGG + Intronic
911177213 1:94828777-94828799 ATTAGAAATCAGGCTAAATAAGG + Intronic
913303993 1:117404732-117404754 AACAGACAGCAAGCAGAATTTGG - Intronic
914908731 1:151767999-151768021 ATCAGACCTCAGGCAGATGGGGG - Intronic
915021667 1:152785787-152785809 ATCAGACAGCAGGCAGATTTGGG + Intronic
915328903 1:155097070-155097092 ATAGGACAACAGGCAGAATGGGG - Intergenic
916757331 1:167785324-167785346 ATCAGCCATCAGGCTGACTTTGG + Intronic
917199995 1:172504563-172504585 ATCTAACATCAGGAAGAAGAAGG + Intergenic
918288585 1:183083422-183083444 AGCATACATCAGGTAGTATATGG - Intronic
918686134 1:187418161-187418183 TCCAGACTTCAGGCAGAAAAAGG - Intergenic
920205308 1:204286929-204286951 AACAGAAACCAGGCACAATAGGG - Intronic
1063644722 10:7867565-7867587 TTCAGACATCAGACAGAATGAGG - Intronic
1063781563 10:9331008-9331030 ACCACACTTCAGGAAGAATAAGG + Intergenic
1065089837 10:22220602-22220624 TCCAGAAATGAGGCAGAATATGG - Intergenic
1068220461 10:54038565-54038587 CTCAGGCATCAGTCAGGATATGG + Intronic
1070078595 10:73163174-73163196 ATCTGACCTCTGGCAAAATATGG - Intronic
1071027097 10:81128015-81128037 ATCAGAACTCTGGCAGAAAAAGG - Intergenic
1073554520 10:104435887-104435909 AGCAGGCTTCAGGCAGAAGATGG - Intronic
1078116651 11:8459552-8459574 ATTAAACATCAGCCAGCATAGGG + Intronic
1079144602 11:17839550-17839572 GTCAGTCCTCAGGCAGAAAAAGG + Intronic
1080017106 11:27519153-27519175 ATCAGACAACACCCAAAATAAGG - Intergenic
1080054614 11:27893152-27893174 ATTAAACATGAGGCAGAATAAGG - Intergenic
1080530480 11:33170550-33170572 TTCAGACATGATGAAGAATAGGG - Intergenic
1083525525 11:63361191-63361213 AGCAGAGTTCAGGCAGAAGAAGG + Intronic
1085646953 11:78230533-78230555 AACTGACATAAGGCAGAATAAGG - Intronic
1086138661 11:83469580-83469602 ATCAGACAACAGGAAGTACAGGG + Intronic
1088728110 11:112657228-112657250 TTCAGTCATCAGGCAGAAATTGG - Intergenic
1091187553 11:133659840-133659862 AACAGACTAAAGGCAGAATATGG + Intergenic
1094178177 12:27563486-27563508 CTCAGAGATGAGGCAGAAGAGGG + Intronic
1094284068 12:28772652-28772674 ATTGGACATCAGGGAGAAAAAGG + Intergenic
1094468445 12:30779605-30779627 ATCAGACAGCAGGGAGAATGGGG + Intergenic
1095837866 12:46658030-46658052 AACAGAAAACAGGCAAAATAGGG + Intergenic
1096019878 12:48315004-48315026 ATTTGACTTCAGGCAGAAGAAGG - Intergenic
1096511747 12:52133817-52133839 AGCAGAAACCAGGCAGAATCTGG + Intergenic
1099637425 12:85231588-85231610 ATCAGACACCAAGCAGATTCTGG - Intronic
1101650826 12:106675733-106675755 AGTAGACATTAGGCAGAAAAAGG + Intronic
1102383492 12:112486937-112486959 AGCAAACATCATGAAGAATAAGG - Intronic
1102483681 12:113241806-113241828 ATGAGACAGCAGGAAGCATAGGG + Intronic
1102867901 12:116388662-116388684 ATCAGACACAAGGCAGCATCTGG - Intergenic
1105773041 13:23630734-23630756 ATCAGACTGAAGGCAGGATATGG - Intronic
1105866254 13:24462011-24462033 AACAGACACAAGGCAGAATTTGG + Intronic
1108186968 13:47897672-47897694 ATCAAAGATCAGACAGGATAAGG - Intergenic
1108567695 13:51717355-51717377 CTTTGACATCAGGGAGAATAGGG + Intronic
1109066545 13:57701536-57701558 ATAAGACATAAAGCAAAATATGG - Intronic
1110492692 13:76127321-76127343 ACCAGAGATCAGGAAGATTAGGG + Intergenic
1110635598 13:77764611-77764633 ATCAAATATAATGCAGAATAAGG - Intergenic
1110899489 13:80802813-80802835 ATCAGCAATGTGGCAGAATAGGG + Intergenic
1111538332 13:89633813-89633835 ATGAAACAGCAGGCAGAATTTGG + Intergenic
1114336202 14:21693091-21693113 ATTAGAAATGAGGAAGAATAGGG + Intergenic
1123905335 15:24915090-24915112 ATCAGATATCAAGGAGAAGAGGG + Intronic
1126419436 15:48455696-48455718 CTCACACAGCAGGCAGAGTAAGG + Intronic
1128013170 15:64317786-64317808 AACAGACATGAGGCTGAATGTGG - Intronic
1128966968 15:72069093-72069115 ATCAGCTATGAGGCAGTATAAGG - Intronic
1129982855 15:79890099-79890121 ATCATCCATCAGGCAGGAGAAGG + Intronic
1130231906 15:82103629-82103651 ATCAGACATCAGTCAAATCAAGG - Intergenic
1130367486 15:83253515-83253537 ATCAGGCTTCAGAAAGAATAGGG + Intergenic
1131334309 15:91532930-91532952 ATCAGACATCAGGCAGAATAGGG - Intergenic
1132586659 16:708471-708493 ATCAGACACCAGGCAGACACAGG - Intronic
1133147780 16:3802901-3802923 AGCGAACATCAGGCAGAACAAGG + Intronic
1133431066 16:5737091-5737113 ATTAGACCTCAAGCAGATTATGG - Intergenic
1133820860 16:9235356-9235378 ATGAGACATCAATCAGCATATGG + Intergenic
1137048703 16:35690619-35690641 GTCTGACATCAGGCAGTCTAAGG - Intergenic
1138934756 16:61705558-61705580 ATCTGAGCTCAGGCATAATAAGG + Intronic
1139696269 16:68677445-68677467 ATCAAAAATCAGGCCGAATGCGG + Intronic
1140398260 16:74647927-74647949 AAAAAAAATCAGGCAGAATATGG - Intronic
1141713808 16:85715680-85715702 AGCAGGCATCAGGCAGGATTGGG + Intronic
1141897792 16:86969789-86969811 ATCAGGCGTCAGTCAGAGTATGG - Intergenic
1147449799 17:40497064-40497086 CTCAGACATCAGGCAGCCGAGGG - Intronic
1147839779 17:43363036-43363058 AGCAGAGACCAGTCAGAATACGG + Intergenic
1148094290 17:45041718-45041740 ATCAGACACCAGGCACGAGAAGG + Intronic
1149327211 17:55544344-55544366 AGTAGACATCAGGCACTATAGGG - Intergenic
1152202032 17:78952786-78952808 ATAAGACACCAGGCAGGCTATGG + Intergenic
1154967912 18:21378083-21378105 ATTTGACTTCAGGCAGAAGATGG - Intronic
1157195555 18:45617659-45617681 ATCACACATCAGGGAGATCAGGG - Intronic
1157926763 18:51775232-51775254 ATCAGACTTAATGCAGAATCAGG + Intergenic
1157946491 18:51986656-51986678 AGCAGACATCAGTCAGAACATGG - Intergenic
1158125194 18:54093132-54093154 AGAAGAGATCAGGCAGAGTAGGG + Intergenic
1158797820 18:60869493-60869515 ATCAGACAACAATCAGAATTAGG + Intergenic
1164456776 19:28414301-28414323 ATAACACATCATGCTGAATAGGG + Intergenic
1164492852 19:28730152-28730174 GTCAGACTTTAGGCAGAAAAAGG + Intergenic
926328122 2:11802976-11802998 AGCTGACATTAGGCAGAAGAGGG - Exonic
926853354 2:17225608-17225630 ATTATACATCAGGCAGAAGATGG + Intergenic
927983315 2:27389075-27389097 ACCAGAGATCATGCAGTATATGG - Intronic
929816063 2:45232583-45232605 ATCTGTCTTCAGGCAGATTAAGG + Intergenic
931620827 2:64207738-64207760 ATCAGACCACAGGTAGATTAGGG + Intergenic
931719795 2:65058795-65058817 ATCAGACATCAGGCTGGGCATGG - Intronic
931904547 2:66828407-66828429 AGCAGACATCAAGCTGAATTTGG + Intergenic
932012993 2:67997134-67997156 TTCAGACTTCAGGTAGAACAGGG - Intergenic
935423198 2:102892212-102892234 AACAGTCTTCAGTCAGAATAGGG + Intergenic
935552333 2:104471009-104471031 AGGAGACCTCAGGGAGAATATGG + Intergenic
936393332 2:112096413-112096435 CTCAGAGGTCAGGCAGAAAAGGG - Intronic
937058486 2:118961403-118961425 ATCTCACATCAGTCAGAATGGGG - Intronic
937838567 2:126499090-126499112 ATCAGAAATCATGGAGACTAAGG + Intergenic
938608167 2:132918226-132918248 CTGAGACATCAGGAAGAAAATGG - Intronic
940070148 2:149677883-149677905 ATCAAACATCACTCAGAAGAAGG + Intergenic
945303001 2:208231782-208231804 ATCAGACATCACCCAGGAGATGG - Intergenic
945722441 2:213434758-213434780 ATCTGACGTAAGTCAGAATATGG + Intronic
948487573 2:238290491-238290513 ATCAGGTAGCAGGCTGAATATGG - Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1169438605 20:5615237-5615259 GTCAGATATATGGCAGAATATGG + Intergenic
1170047166 20:12097787-12097809 ATCAGACATGGGACAAAATAAGG - Intergenic
1170157243 20:13279877-13279899 ACCAAAGATCAGCCAGAATATGG + Exonic
1173422011 20:42909735-42909757 ATCAGACCTCAGGCAGGAGATGG + Intronic
1173945463 20:46946724-46946746 ACCAGACAGCAGCCAGAATTTGG + Intronic
1177070457 21:16499276-16499298 ACTAGACATCAGGCAAAATAAGG - Intergenic
1177668658 21:24195709-24195731 ATCAGACATCATCTAGAAGATGG - Intergenic
1180863554 22:19102074-19102096 ATCAGCCATCAGCCATAAAAAGG + Intronic
1181822980 22:25490149-25490171 AGCAGCCATCAGGCACCATAAGG + Intergenic
1185338085 22:50279715-50279737 ATCAAACATCAGGTGGAAAAGGG - Exonic
950903962 3:16520756-16520778 ATCAGACAACAGGCAGCCTGAGG + Intergenic
951923178 3:27877996-27878018 AACAGAGACCAGGCAGAATATGG - Intergenic
952427494 3:33190735-33190757 ATCTGTCATCAGGCAGACAAGGG - Intronic
952570721 3:34712659-34712681 AGCTGTCAGCAGGCAGAATAAGG + Intergenic
954871117 3:53768150-53768172 ATCAGACTTGAAGCAGAATAGGG + Intronic
956951219 3:74285408-74285430 ATGAGACATCAGCCAGACTACGG - Exonic
958868543 3:99529934-99529956 AACAGACCTCAGGCAGAGCATGG + Intergenic
958981568 3:100726291-100726313 ATCACAAAACAGGCAGAAGAAGG - Intronic
963044964 3:141095545-141095567 CCCAGACATCAGGCAGAAGAAGG + Intronic
963045042 3:141095953-141095975 CCCAGACATCAGGCAGAAGAAGG - Intronic
968313341 3:197702138-197702160 ATCAGAAGTCAGACAGACTAGGG + Intronic
968320254 3:197761783-197761805 ATCAGACATCATGTAGACTCTGG - Intronic
970173230 4:13309776-13309798 ATCAGACATGACACATAATAGGG - Intergenic
970511894 4:16789183-16789205 ATCAGACACCAGGCAGATGCTGG + Intronic
971341568 4:25774206-25774228 CTCAGAGATCAGATAGAATATGG + Intronic
973329530 4:48898080-48898102 GTCAGACATGAAGTAGAATAGGG - Intronic
974467244 4:62272982-62273004 CTCAGAGATCAGACAGAAAAGGG - Intergenic
976816397 4:89152220-89152242 ATCAGGCATCAGGTAGAAGTTGG + Intergenic
980432157 4:132715931-132715953 ATAAAACAGCAGGCAGAATTGGG - Intergenic
982862395 4:160469666-160469688 ATCAGACAACAGTCAGTTTATGG - Intergenic
986918249 5:12652209-12652231 ATCAGACAATAGGCAGTGTAGGG + Intergenic
988133296 5:27135617-27135639 ATGAGACATCAAGTAGAAGAGGG + Intergenic
988215793 5:28270462-28270484 TTCAGACATCAGGGAAAATACGG - Intergenic
991257798 5:64634236-64634258 ATCAGACATCATCCAGAAGATGG + Intergenic
993465546 5:88241732-88241754 ATTAGCCATCATGGAGAATATGG - Intronic
993677107 5:90829832-90829854 ATCATACTTCAAGCAGAGTAGGG - Intronic
993935652 5:93998433-93998455 ATCTGACATGAGCCAGAAGAAGG - Intronic
998397448 5:141827791-141827813 AACAGACATCAGACAGACTGAGG - Intergenic
999617269 5:153437561-153437583 ATCAGACATCTGGGAGAAGTGGG - Intergenic
999701764 5:154234778-154234800 TTCTGACAGTAGGCAGAATATGG + Intronic
1000000347 5:157132513-157132535 ATCAGACAGCAGGCTGGATTTGG - Intronic
1000531488 5:162426926-162426948 TTCACACATCAGGAAGACTAAGG - Intergenic
1001223228 5:169921225-169921247 ATCTTACATCAGGAGGAATACGG - Intronic
1003804810 6:9715066-9715088 TTCAGCCATCAGGCAGCATATGG - Intronic
1009505872 6:64477482-64477504 ATCAGACGTCAGACAGGATGAGG - Intronic
1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG + Intergenic
1011059177 6:83244022-83244044 ATAAGACACCAGGCATAATTGGG + Intronic
1011231477 6:85166309-85166331 CTCACACTTCAGGCAGGATATGG + Intergenic
1011431829 6:87295504-87295526 TTCCTACATCAGGCAGAAGATGG - Intronic
1013969292 6:115997635-115997657 ATCAGAAATGGGGCAAAATAAGG - Intronic
1014282142 6:119453401-119453423 ATGAGAAATCAGGCAGCACAGGG + Intergenic
1014915622 6:127144590-127144612 AGAAGACATCATGCAAAATAGGG - Intronic
1016144903 6:140657919-140657941 ATAAGAGATTAGGCAGAAGAGGG - Intergenic
1017082722 6:150684481-150684503 ATCAGCCACCAGACAGCATATGG - Intronic
1018867493 6:167757739-167757761 ACCAGACACCAGGCGGAATATGG + Intergenic
1019842532 7:3462656-3462678 ATGAGGCATCAAGAAGAATAAGG - Intronic
1021345475 7:19521985-19522007 ATGAGACATCAAGTAAAATAAGG + Intergenic
1023510229 7:40945065-40945087 TTCAGACTTCAGGCAGTAGAGGG + Intergenic
1024354693 7:48402654-48402676 CTTAGTCATCAGGCAGAAAATGG + Intronic
1026865864 7:73823644-73823666 ATCAGACATTAGGCAGGGTGTGG + Intronic
1027677318 7:81176526-81176548 ATCAGACATCAAGCAGAATATGG - Intronic
1028357349 7:89925403-89925425 AACAGACAGCAGGCTGAATTTGG - Intergenic
1032333005 7:130997956-130997978 TTGAGAAATCATGCAGAATAGGG - Intergenic
1032617510 7:133490498-133490520 TTCAGGCATCAGGCACAGTATGG + Intronic
1037426094 8:18756337-18756359 AGCAGACCTCAGTCAGAAAAAGG - Intronic
1038195205 8:25360802-25360824 TTCAGAGAGCAGGCAAAATAGGG + Intronic
1038657614 8:29468574-29468596 ATCAGGCATCAGGTTGAATTGGG - Intergenic
1040854958 8:51939502-51939524 ATCAGGAGTCACGCAGAATATGG - Intergenic
1043072922 8:75661944-75661966 ATCTGAGATCAGGAAGAAAAAGG - Intergenic
1043157304 8:76799828-76799850 ATCAGACATTACATAGAATAAGG - Intronic
1043921196 8:85985351-85985373 ATCAGACATCAGAGAGAAACTGG + Intergenic
1046018431 8:108634502-108634524 CTGAGACATCCTGCAGAATAAGG + Intronic
1047663811 8:127067676-127067698 CTCAGAGCTCAGGCAGAAAAAGG + Intergenic
1047797122 8:128268920-128268942 ACCAGAGATGAGGCAGAATTGGG - Intergenic
1048561058 8:135538052-135538074 CTCAGAAGTCAGGCAGAAAAAGG + Intronic
1050179578 9:2905797-2905819 AGCAGACAACAGGAAGAAAAGGG + Intergenic
1050317220 9:4414810-4414832 ATCAGACATCATCTGGAATACGG - Intergenic
1050595194 9:7197960-7197982 ATGAGACATAAAGCAGAATAAGG - Intergenic
1050882287 9:10717468-10717490 ATAAGACATCAGTTTGAATAGGG - Intergenic
1050936914 9:11409815-11409837 ATAAGACATCTGAAAGAATATGG + Intergenic
1050941616 9:11467791-11467813 ATAAAACATGAGGCATAATAGGG - Intergenic
1051577237 9:18630662-18630684 ATTGGACATCAGGCAAAAAAGGG - Intronic
1052885294 9:33641028-33641050 ATCAGACAACAGGCAGTATGGGG + Intergenic
1055654192 9:78437074-78437096 ATCAGTCACCAGGGAGAAAATGG + Intergenic
1058918546 9:109591011-109591033 ATCAGACCACAGGCAAAGTATGG - Intergenic
1059983377 9:119797607-119797629 ACAGGACATCAGGCAGAGTATGG - Intergenic
1060010332 9:120038134-120038156 AGCAGACAGCAGGCAGCATTTGG - Intergenic
1186103598 X:6182354-6182376 AGCAGCCATCAGGGAGAAAAAGG + Intronic
1187869730 X:23754549-23754571 ATCAGACATCAGTAACAATCAGG - Intronic
1188102482 X:26106864-26106886 ATCAGCAATCTGGCAGAGTATGG - Intergenic
1189891301 X:45605135-45605157 TTCACAGATCAGGCAGAGTAGGG + Intergenic
1191958620 X:66674227-66674249 AACAGGCCTCAGGCTGAATATGG + Intergenic
1192116707 X:68418470-68418492 GACAGACATCAGGGAGAATCAGG + Intronic
1192968787 X:76208509-76208531 ATCAGAAAAAAGGCAAAATATGG - Intergenic
1193899664 X:87161747-87161769 ATAAGAAACCAGGCAGAATCTGG - Intergenic
1194838356 X:98709783-98709805 ATTATACATCTGGCAGAATTTGG + Intergenic
1195644958 X:107220433-107220455 ATCAAACATCAGGATGAAAAGGG - Intronic
1198523019 X:137471856-137471878 ATGAGACAGCAGGTAGAATGAGG + Intergenic
1199991948 X:152992468-152992490 AGCTGAAATCAGGCAGAAAAGGG + Intronic
1200734373 Y:6778071-6778093 TTAAGACATCAGGAAGAACATGG + Intergenic