ID: 1131337538

View in Genome Browser
Species Human (GRCh38)
Location 15:91563699-91563721
Sequence ATTAGTAAAGTTACCTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131337535_1131337538 27 Left 1131337535 15:91563649-91563671 CCAGTCAGTAGCATAAGAGGGCT No data
Right 1131337538 15:91563699-91563721 ATTAGTAAAGTTACCTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131337538 Original CRISPR ATTAGTAAAGTTACCTTACA AGG Intergenic
No off target data available for this crispr