ID: 1131339895

View in Genome Browser
Species Human (GRCh38)
Location 15:91589048-91589070
Sequence CATTTTTCCTAATGGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131339895_1131339900 24 Left 1131339895 15:91589048-91589070 CCTACTGCCCATTAGGAAAAATG No data
Right 1131339900 15:91589095-91589117 CACAGAGAAAGAGATGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131339895 Original CRISPR CATTTTTCCTAATGGGCAGT AGG (reversed) Intergenic
No off target data available for this crispr