ID: 1131341923

View in Genome Browser
Species Human (GRCh38)
Location 15:91610631-91610653
Sequence CTTGGAAATCAGATGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131341923_1131341931 21 Left 1131341923 15:91610631-91610653 CCTAGCACCATCTGATTTCCAAG No data
Right 1131341931 15:91610675-91610697 TCTGAGTTGCAGGAGGAATGAGG No data
1131341923_1131341930 14 Left 1131341923 15:91610631-91610653 CCTAGCACCATCTGATTTCCAAG No data
Right 1131341930 15:91610668-91610690 TCTATTCTCTGAGTTGCAGGAGG No data
1131341923_1131341928 11 Left 1131341923 15:91610631-91610653 CCTAGCACCATCTGATTTCCAAG No data
Right 1131341928 15:91610665-91610687 TCCTCTATTCTCTGAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131341923 Original CRISPR CTTGGAAATCAGATGGTGCT AGG (reversed) Intergenic
No off target data available for this crispr