ID: 1131341923 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:91610631-91610653 |
Sequence | CTTGGAAATCAGATGGTGCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1131341923_1131341931 | 21 | Left | 1131341923 | 15:91610631-91610653 | CCTAGCACCATCTGATTTCCAAG | No data | ||
Right | 1131341931 | 15:91610675-91610697 | TCTGAGTTGCAGGAGGAATGAGG | No data | ||||
1131341923_1131341930 | 14 | Left | 1131341923 | 15:91610631-91610653 | CCTAGCACCATCTGATTTCCAAG | No data | ||
Right | 1131341930 | 15:91610668-91610690 | TCTATTCTCTGAGTTGCAGGAGG | No data | ||||
1131341923_1131341928 | 11 | Left | 1131341923 | 15:91610631-91610653 | CCTAGCACCATCTGATTTCCAAG | No data | ||
Right | 1131341928 | 15:91610665-91610687 | TCCTCTATTCTCTGAGTTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1131341923 | Original CRISPR | CTTGGAAATCAGATGGTGCT AGG (reversed) | Intergenic | ||
No off target data available for this crispr |