ID: 1131343781

View in Genome Browser
Species Human (GRCh38)
Location 15:91627455-91627477
Sequence AATCATCGCGTAGAAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131343781_1131343782 -2 Left 1131343781 15:91627455-91627477 CCACTGGCTTCTACGCGATGATT No data
Right 1131343782 15:91627476-91627498 TTTGTTAAAGAAAACAGAAGTGG No data
1131343781_1131343783 7 Left 1131343781 15:91627455-91627477 CCACTGGCTTCTACGCGATGATT No data
Right 1131343783 15:91627485-91627507 GAAAACAGAAGTGGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131343781 Original CRISPR AATCATCGCGTAGAAGCCAG TGG (reversed) Intergenic
No off target data available for this crispr