ID: 1131344210

View in Genome Browser
Species Human (GRCh38)
Location 15:91631094-91631116
Sequence CTGACAGATATTCCCAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131344210_1131344223 17 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344223 15:91631134-91631156 CCCAGGGCCAGCCCAGAGGGTGG No data
1131344210_1131344221 14 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344221 15:91631131-91631153 CCTCCCAGGGCCAGCCCAGAGGG No data
1131344210_1131344219 13 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344219 15:91631130-91631152 GCCTCCCAGGGCCAGCCCAGAGG No data
1131344210_1131344228 25 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344228 15:91631142-91631164 CAGCCCAGAGGGTGGGTGGATGG No data
1131344210_1131344215 1 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344215 15:91631118-91631140 TTCCTTCCCTGGGCCTCCCAGGG No data
1131344210_1131344226 21 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344226 15:91631138-91631160 GGGCCAGCCCAGAGGGTGGGTGG No data
1131344210_1131344230 28 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344230 15:91631145-91631167 CCCAGAGGGTGGGTGGATGGTGG No data
1131344210_1131344225 18 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344225 15:91631135-91631157 CCAGGGCCAGCCCAGAGGGTGGG No data
1131344210_1131344213 -9 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344213 15:91631108-91631130 ATCTGTCAGTTTCCTTCCCTGGG No data
1131344210_1131344212 -10 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344212 15:91631107-91631129 TATCTGTCAGTTTCCTTCCCTGG No data
1131344210_1131344214 0 Left 1131344210 15:91631094-91631116 CCCAGTCTGGGAATATCTGTCAG No data
Right 1131344214 15:91631117-91631139 TTTCCTTCCCTGGGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131344210 Original CRISPR CTGACAGATATTCCCAGACT GGG (reversed) Intergenic