ID: 1131347953

View in Genome Browser
Species Human (GRCh38)
Location 15:91668622-91668644
Sequence AGATCTGGGCCACCTGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131347953_1131347958 1 Left 1131347953 15:91668622-91668644 CCTGTGACAGGTGGCCCAGATCT No data
Right 1131347958 15:91668646-91668668 CAAAGATGGTGCTGTGAGTAGGG No data
1131347953_1131347960 21 Left 1131347953 15:91668622-91668644 CCTGTGACAGGTGGCCCAGATCT No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data
1131347953_1131347957 0 Left 1131347953 15:91668622-91668644 CCTGTGACAGGTGGCCCAGATCT No data
Right 1131347957 15:91668645-91668667 TCAAAGATGGTGCTGTGAGTAGG No data
1131347953_1131347959 20 Left 1131347953 15:91668622-91668644 CCTGTGACAGGTGGCCCAGATCT No data
Right 1131347959 15:91668665-91668687 AGGGAATAATCATGTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131347953 Original CRISPR AGATCTGGGCCACCTGTCAC AGG (reversed) Intergenic