ID: 1131347955

View in Genome Browser
Species Human (GRCh38)
Location 15:91668636-91668658
Sequence AGCACCATCTTTGAAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131347955_1131347959 6 Left 1131347955 15:91668636-91668658 CCCAGATCTTCAAAGATGGTGCT No data
Right 1131347959 15:91668665-91668687 AGGGAATAATCATGTTTTACTGG No data
1131347955_1131347960 7 Left 1131347955 15:91668636-91668658 CCCAGATCTTCAAAGATGGTGCT No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131347955 Original CRISPR AGCACCATCTTTGAAGATCT GGG (reversed) Intergenic