ID: 1131347956 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:91668637-91668659 |
| Sequence | CAGCACCATCTTTGAAGATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131347956_1131347959 | 5 | Left | 1131347956 | 15:91668637-91668659 | CCAGATCTTCAAAGATGGTGCTG | No data | ||
| Right | 1131347959 | 15:91668665-91668687 | AGGGAATAATCATGTTTTACTGG | No data | ||||
| 1131347956_1131347960 | 6 | Left | 1131347956 | 15:91668637-91668659 | CCAGATCTTCAAAGATGGTGCTG | No data | ||
| Right | 1131347960 | 15:91668666-91668688 | GGGAATAATCATGTTTTACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131347956 | Original CRISPR | CAGCACCATCTTTGAAGATC TGG (reversed) | Intergenic | ||