ID: 1131347956

View in Genome Browser
Species Human (GRCh38)
Location 15:91668637-91668659
Sequence CAGCACCATCTTTGAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131347956_1131347959 5 Left 1131347956 15:91668637-91668659 CCAGATCTTCAAAGATGGTGCTG No data
Right 1131347959 15:91668665-91668687 AGGGAATAATCATGTTTTACTGG No data
1131347956_1131347960 6 Left 1131347956 15:91668637-91668659 CCAGATCTTCAAAGATGGTGCTG No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131347956 Original CRISPR CAGCACCATCTTTGAAGATC TGG (reversed) Intergenic