ID: 1131347958

View in Genome Browser
Species Human (GRCh38)
Location 15:91668646-91668668
Sequence CAAAGATGGTGCTGTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131347952_1131347958 9 Left 1131347952 15:91668614-91668636 CCAGGGAGCCTGTGACAGGTGGC No data
Right 1131347958 15:91668646-91668668 CAAAGATGGTGCTGTGAGTAGGG No data
1131347953_1131347958 1 Left 1131347953 15:91668622-91668644 CCTGTGACAGGTGGCCCAGATCT No data
Right 1131347958 15:91668646-91668668 CAAAGATGGTGCTGTGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131347958 Original CRISPR CAAAGATGGTGCTGTGAGTA GGG Intergenic