ID: 1131347960

View in Genome Browser
Species Human (GRCh38)
Location 15:91668666-91668688
Sequence GGGAATAATCATGTTTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131347956_1131347960 6 Left 1131347956 15:91668637-91668659 CCAGATCTTCAAAGATGGTGCTG No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data
1131347952_1131347960 29 Left 1131347952 15:91668614-91668636 CCAGGGAGCCTGTGACAGGTGGC No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data
1131347955_1131347960 7 Left 1131347955 15:91668636-91668658 CCCAGATCTTCAAAGATGGTGCT No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data
1131347953_1131347960 21 Left 1131347953 15:91668622-91668644 CCTGTGACAGGTGGCCCAGATCT No data
Right 1131347960 15:91668666-91668688 GGGAATAATCATGTTTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131347960 Original CRISPR GGGAATAATCATGTTTTACT GGG Intergenic