ID: 1131349757

View in Genome Browser
Species Human (GRCh38)
Location 15:91688434-91688456
Sequence TGTTCAGAATAGGCATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131349753_1131349757 22 Left 1131349753 15:91688389-91688411 CCAGTCACAAAAGGCCACACACT No data
Right 1131349757 15:91688434-91688456 TGTTCAGAATAGGCATCTTCAGG No data
1131349754_1131349757 8 Left 1131349754 15:91688403-91688425 CCACACACTGTTTGATTCCACTT No data
Right 1131349757 15:91688434-91688456 TGTTCAGAATAGGCATCTTCAGG No data
1131349755_1131349757 -9 Left 1131349755 15:91688420-91688442 CCACTTATATGAAATGTTCAGAA 0: 4
1: 99
2: 676
3: 1654
4: 2478
Right 1131349757 15:91688434-91688456 TGTTCAGAATAGGCATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131349757 Original CRISPR TGTTCAGAATAGGCATCTTC AGG Intergenic
No off target data available for this crispr