ID: 1131351497

View in Genome Browser
Species Human (GRCh38)
Location 15:91704919-91704941
Sequence CAGCTTTAATGGCCTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131351495_1131351497 -9 Left 1131351495 15:91704905-91704927 CCTCTCTGCTTTCACAGCTTTAA No data
Right 1131351497 15:91704919-91704941 CAGCTTTAATGGCCTCATTGTGG No data
1131351494_1131351497 -8 Left 1131351494 15:91704904-91704926 CCCTCTCTGCTTTCACAGCTTTA No data
Right 1131351497 15:91704919-91704941 CAGCTTTAATGGCCTCATTGTGG No data
1131351493_1131351497 4 Left 1131351493 15:91704892-91704914 CCAATTTCTCATCCCTCTCTGCT No data
Right 1131351497 15:91704919-91704941 CAGCTTTAATGGCCTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131351497 Original CRISPR CAGCTTTAATGGCCTCATTG TGG Intergenic
No off target data available for this crispr