ID: 1131357653

View in Genome Browser
Species Human (GRCh38)
Location 15:91759585-91759607
Sequence CTTGATATTCAGCACAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131357653_1131357655 26 Left 1131357653 15:91759585-91759607 CCAAGTCTGTGCTGAATATCAAG No data
Right 1131357655 15:91759634-91759656 AGTCTGTGATCCCTCTATAGAGG No data
1131357653_1131357654 -7 Left 1131357653 15:91759585-91759607 CCAAGTCTGTGCTGAATATCAAG No data
Right 1131357654 15:91759601-91759623 TATCAAGTTTAAGTGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131357653 Original CRISPR CTTGATATTCAGCACAGACT TGG (reversed) Intergenic
No off target data available for this crispr