ID: 1131359223

View in Genome Browser
Species Human (GRCh38)
Location 15:91774722-91774744
Sequence CTCTGGGTATGAAGTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131359215_1131359223 24 Left 1131359215 15:91774675-91774697 CCTCGTGTGTCCATATCTAATTA No data
Right 1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG No data
1131359217_1131359223 14 Left 1131359217 15:91774685-91774707 CCATATCTAATTATGTAACAGGA No data
Right 1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131359223 Original CRISPR CTCTGGGTATGAAGTCCAGT GGG Intergenic
No off target data available for this crispr