ID: 1131371068

View in Genome Browser
Species Human (GRCh38)
Location 15:91882366-91882388
Sequence CATAGCTCCCAGTTTAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131371065_1131371068 3 Left 1131371065 15:91882340-91882362 CCCATGCATTTGCTTCTCTTTGT 0: 1
1: 0
2: 5
3: 234
4: 3963
Right 1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 100
1131371066_1131371068 2 Left 1131371066 15:91882341-91882363 CCATGCATTTGCTTCTCTTTGTG 0: 1
1: 0
2: 3
3: 46
4: 538
Right 1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 100
1131371064_1131371068 24 Left 1131371064 15:91882319-91882341 CCTTAAATGGTATATATTGAACC 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131371068 Original CRISPR CATAGCTCCCAGTTTAAGGT TGG Intronic
901245409 1:7726408-7726430 CATTGTTCCCACTTGAAGGTAGG + Intronic
902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG + Intronic
908715090 1:67061350-67061372 CATTTCTCCCAGTTGAAGGCTGG - Intergenic
912604211 1:110971859-110971881 CATAACTCCCACTTAAAAGTGGG - Intergenic
915472544 1:156134670-156134692 CTCAGCTCCCAGGTTAAAGTGGG + Intronic
917634746 1:176924251-176924273 CATAGCTCCTAGAATAATGTAGG - Intronic
919877742 1:201882892-201882914 CATAGCTCCCAGCTATGGGTGGG - Exonic
1064328557 10:14373102-14373124 CAGAGCTCCCAGTCTAGTGTGGG - Intronic
1064913520 10:20429865-20429887 CAGAGCACACAGTTTTAGGTGGG + Intergenic
1065164041 10:22955825-22955847 CACAGCTCCAAGTTCAAGGAGGG - Exonic
1070447103 10:76515990-76516012 CATATCCCCCAGTGTATGGTGGG - Intronic
1070904518 10:80059939-80059961 CATAGCACTCAGTATAAGCTGGG - Intergenic
1074455433 10:113591697-113591719 CTTATCTCCCAGATTAATGTAGG - Intronic
1074796878 10:116955640-116955662 CAGATCTCCCAGATTAAAGTGGG - Intronic
1076038965 10:127226859-127226881 CATGCCTCCCAGGTGAAGGTGGG - Intronic
1076150397 10:128157605-128157627 AATACCTGCCAGTTAAAGGTTGG - Intergenic
1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG + Intronic
1083945743 11:65921614-65921636 CCCAGCTCCCAGTTTCATGTGGG - Intergenic
1084528095 11:69709976-69709998 CATAGCTCCCATTCTAAAGAGGG + Intergenic
1087889471 11:103520434-103520456 TCTAACCCCCAGTTTAAGGTGGG + Intergenic
1092183756 12:6463628-6463650 CCTAGCTCCCAGTTAATTGTTGG - Intronic
1093431071 12:19085474-19085496 CATAGCTGTCAGTATAAGTTTGG + Intergenic
1095585362 12:43843690-43843712 GATATCCCCAAGTTTAAGGTTGG - Intronic
1098303060 12:69074113-69074135 CTTAGCTCCCACTTATAGGTGGG - Intergenic
1098503585 12:71223242-71223264 CATAGCTCCAATTCAAAGGTGGG - Intronic
1101759908 12:107649965-107649987 CAAAGCTCCCAGTTTCAATTAGG - Intronic
1102646618 12:114407960-114407982 CGTACCTCCCAGCTCAAGGTTGG + Exonic
1104873860 12:132019406-132019428 TATAGTTCCCAGCTTAAAGTGGG + Intronic
1106406841 13:29481814-29481836 CACACCTCCCTGTTTGAGGTGGG + Intronic
1109209621 13:59519820-59519842 CCCAACTCCCAGTTTAAGGATGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1121031566 14:90662657-90662679 CATAGTTCCCATTTTACAGTGGG - Intronic
1126218816 15:46188113-46188135 CATAGTTCGCAGTTTGAGATAGG - Intergenic
1126994773 15:54428573-54428595 CAGAGCTTACAGTCTAAGGTGGG - Intronic
1128458840 15:67850796-67850818 CACAGCTGTCAGTTAAAGGTGGG + Intergenic
1129333928 15:74841400-74841422 CAGACCTGCCAGTTTTAGGTGGG + Exonic
1130615657 15:85404746-85404768 CCTAGCTCCCAGCTTATGGTAGG + Intronic
1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG + Intronic
1133967464 16:10541832-10541854 CATAGGCCCCATTTTAAGATGGG - Intronic
1134092896 16:11401012-11401034 GATAGCTCACATTTTAATGTGGG - Intronic
1137508429 16:49076940-49076962 CAGAGATCCCTGTTTTAGGTAGG - Intergenic
1146809268 17:35890453-35890475 GATAGCTTCCAGTCTCAGGTGGG - Intergenic
1148009592 17:44466127-44466149 CATACCTCCCAGGCTGAGGTGGG - Intronic
1148261162 17:46184705-46184727 CATTACTCCCAGGTTGAGGTGGG + Intronic
1149382825 17:56110912-56110934 CAGAGCTCCCAGTTCCTGGTTGG + Intergenic
1156156879 18:34313859-34313881 GATAACACCCAGTTTAGGGTGGG + Intergenic
1156631453 18:38974363-38974385 CATAGCCCCCTGTTTTGGGTGGG + Intergenic
1156877656 18:42034972-42034994 CATAACACCCAGTTAAAGTTAGG - Intronic
1157158687 18:45292108-45292130 CATTCCTGCCAGATTAAGGTCGG - Intronic
1158703303 18:59768903-59768925 CATGGCTCCCAGTTTCAAGTGGG + Intergenic
1158983014 18:62783711-62783733 AATAGCTACCAGTTTATGTTTGG + Intronic
1160630047 18:80240613-80240635 CATAGCTCCCAGAAGCAGGTAGG - Intronic
929844182 2:45504621-45504643 GATAGCTACCTGTTTAAGGAAGG - Intronic
930144965 2:47992464-47992486 CACAGCACCCAGTTTAGGCTGGG - Intergenic
931821323 2:65955137-65955159 GATAGCTACCAGGTTTAGGTGGG - Intergenic
932307079 2:70711702-70711724 CATAGGTCAGAGTGTAAGGTGGG - Intronic
933586816 2:84188130-84188152 CATAACTCCCAGTTTATTGCGGG - Intergenic
934045878 2:88172098-88172120 CATAGCTCTCAGTATTAGCTTGG - Exonic
939695161 2:145314374-145314396 CACAGCTTCCAGTTTTAGGGTGG - Intergenic
1172608919 20:36234906-36234928 CAAAGCTCCCTGTTTCAGTTGGG - Intergenic
1181904958 22:26187004-26187026 CACACCTCCCAGCTTAAGATAGG + Intronic
1182265313 22:29110189-29110211 CAGAGCTCCCAGTTGAATGCAGG - Intronic
1182829469 22:33293023-33293045 CATAGCTCACAGTGTAGGGAGGG + Intronic
1183165997 22:36147859-36147881 CATAGTTGGCAGTTTAAGGGGGG - Intronic
949502195 3:4691543-4691565 CATAGCAACCAATTTAAGGAAGG + Intronic
953637624 3:44676308-44676330 CCTAGCTCTCAGGCTAAGGTAGG + Intergenic
958478856 3:94621090-94621112 CAAAGCTCCCAGGTTTAGTTTGG + Intergenic
959421385 3:106134009-106134031 CTTAACTCCCAGTTTAAGGTAGG - Intergenic
962427097 3:135280543-135280565 CATAGCTTCCACTTTTTGGTAGG + Intergenic
962847605 3:139285690-139285712 CATTGCTCCCATTTTCAGGCAGG - Intronic
963107237 3:141657788-141657810 AAAAGCTCCCATTTTCAGGTGGG + Intergenic
964217349 3:154301083-154301105 CACAGATCCCAGTTTAAGAGGGG - Exonic
968620078 4:1600024-1600046 CATAGCACCCAGTGAAAAGTGGG - Intergenic
972271510 4:37514837-37514859 CATTGCTGGCAGTTTAATGTTGG + Intronic
973720643 4:53720251-53720273 CATAGCCACCAGAGTAAGGTGGG - Intronic
973964858 4:56151800-56151822 CATATCTCTCAGTTTATGATTGG + Intergenic
974714623 4:65651194-65651216 CAAAGCTTTCAGATTAAGGTTGG + Intronic
978150969 4:105434328-105434350 CATAATTGCCAGTTTAAAGTTGG + Intronic
978854803 4:113382228-113382250 CACTGCTCCCAGTTAAAGGTGGG + Exonic
981428671 4:144634835-144634857 CATAGCCCCAAGGTTAAGGAAGG + Intergenic
989622274 5:43396435-43396457 CCTAGCTCCTATTTTAAGATGGG + Intronic
993347692 5:86805405-86805427 CATTGCTCTCAGGTTATGGTGGG + Intergenic
1001611223 5:173003702-173003724 GATGGCTCCCAGTTCTAGGTTGG + Intronic
1007883041 6:45188380-45188402 CATAACTTGCAGTTTGAGGTGGG - Intronic
1013775175 6:113671428-113671450 AAGAGCTCACAGTGTAAGGTGGG - Intergenic
1018115386 6:160578622-160578644 CATGGATCCCAGTGTCAGGTGGG - Exonic
1018116944 6:160595453-160595475 CATGGATCCCAGTGTCAGGTGGG - Exonic
1018148073 6:160912125-160912147 CATGGGTCCCAGTGTCAGGTGGG + Intergenic
1018939850 6:168301856-168301878 CATAGCTCCCAGTTCCACCTGGG - Intronic
1030438853 7:109559763-109559785 GGTAGCTGCCAGTATAAGGTTGG - Intergenic
1034907081 7:154958933-154958955 CATAACTACTAGTTTAAGCTAGG + Intronic
1038451713 8:27643616-27643638 AATAGCTATTAGTTTAAGGTTGG - Intronic
1039230248 8:35438713-35438735 CAAGGCTCCAAGTATAAGGTTGG + Intronic
1042758600 8:72246178-72246200 TATAGATCCCTGTTTAAGTTTGG - Intergenic
1042951790 8:74207554-74207576 GATATCCCCCAGTTTAAGCTGGG + Intergenic
1045054845 8:98360055-98360077 CATATGTCCCAGTTTATGGTGGG - Intergenic
1050187228 9:2987292-2987314 GATAGCTTCCAGCTTGAGGTGGG + Intergenic
1051484703 9:17595459-17595481 CATGGATCCCCGTTTATGGTGGG + Intronic
1054865386 9:69995068-69995090 CAGAAATCCCATTTTAAGGTAGG - Intergenic
1188178603 X:27025044-27025066 CATAATTCACAGTTTAAGGTAGG - Intergenic
1190051002 X:47148461-47148483 CATACTTTCCAGTTCAAGGTAGG + Intronic
1192796529 X:74428218-74428240 CATAGCACCCAGCTTCAGGCAGG - Intronic
1195772162 X:108362934-108362956 CATACCTCAAAGTTTAAGGATGG - Intronic
1196929435 X:120666531-120666553 CATGGATCCCACTTTGAGGTAGG + Intergenic
1198671881 X:139090030-139090052 CATAGCTCCCAGGATACAGTAGG + Intronic
1199482182 X:148309825-148309847 CATTGCTCCAAATTAAAGGTTGG - Intergenic