ID: 1131373683

View in Genome Browser
Species Human (GRCh38)
Location 15:91905929-91905951
Sequence CAGCAAGGTGGCCCGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 69}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131373683_1131373696 24 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373696 15:91905976-91905998 CTTGGGTGCTATGGGACCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 126
1131373683_1131373699 30 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373699 15:91905982-91906004 TGCTATGGGACCAGTGGGGTTGG 0: 1
1: 0
2: 0
3: 22
4: 303
1131373683_1131373694 15 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373694 15:91905967-91905989 GCTTGGTCACTTGGGTGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 97
1131373683_1131373692 6 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373692 15:91905958-91905980 GGGCACAGTGCTTGGTCACTTGG 0: 1
1: 0
2: 1
3: 13
4: 168
1131373683_1131373698 26 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373698 15:91905978-91906000 TGGGTGCTATGGGACCAGTGGGG 0: 1
1: 0
2: 2
3: 17
4: 193
1131373683_1131373693 7 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373693 15:91905959-91905981 GGCACAGTGCTTGGTCACTTGGG 0: 1
1: 0
2: 2
3: 15
4: 157
1131373683_1131373691 -2 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373691 15:91905950-91905972 TGACGCAGGGGCACAGTGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 164
1131373683_1131373695 16 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373695 15:91905968-91905990 CTTGGTCACTTGGGTGCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1131373683_1131373697 25 Left 1131373683 15:91905929-91905951 CCCCAAGTCGGGCCACCTTGCTG 0: 1
1: 0
2: 0
3: 12
4: 69
Right 1131373697 15:91905977-91905999 TTGGGTGCTATGGGACCAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131373683 Original CRISPR CAGCAAGGTGGCCCGACTTG GGG (reversed) Intronic
908356645 1:63329597-63329619 CAGCAAGAAGGCGCCACTTGAGG + Intergenic
912189763 1:107324215-107324237 CAGCAATATGGCAAGACTTGTGG + Intronic
916811961 1:168313525-168313547 CAGCAGTGTGCCCAGACTTGTGG + Exonic
919863309 1:201758008-201758030 CAGTATGGTGGCCCCACTTGTGG + Intronic
920365075 1:205444021-205444043 CAGCAAGGGGACCTGACTTCAGG - Intronic
923259839 1:232258148-232258170 CAGCAAGGTGGCCAGGGTGGTGG + Intergenic
1068009090 10:51425581-51425603 CAGCAGGGAGGCCTGGCTTGGGG + Intronic
1076582324 10:131520103-131520125 CAGCAACGTGGCCAGACCTCAGG + Intergenic
1076655805 10:132022572-132022594 CAGCAGGGAGGCCCCACATGCGG - Intergenic
1077113375 11:871825-871847 CAGAAAGGTGGCTCGAGGTGCGG - Intronic
1079752145 11:24212890-24212912 CACCAAGCAGGCCCCACTTGTGG + Intergenic
1081831429 11:46119693-46119715 CAGCAAGGTGGCCCTGGTAGGGG - Intronic
1082079694 11:48002708-48002730 CAGCAAGGTGACCTGACCTCAGG - Intronic
1091100221 11:132865023-132865045 CAGCAAAGCGGCCTGACTTGCGG - Intronic
1101579245 12:106027017-106027039 CAGCAAAGTGGCCCCAACTGTGG - Intergenic
1102444658 12:112992660-112992682 CAGAAAGGTGGCCTGGCTTGGGG + Intronic
1109075738 13:57832443-57832465 CAGCCAGGTGGCCCAACTCCAGG + Intergenic
1113048754 13:106185321-106185343 CTGCAAGGTGGCTTGACTGGTGG - Intergenic
1116090078 14:40293775-40293797 CCGCCAGGTGGCCCGACTTTAGG - Intergenic
1123809082 15:23905290-23905312 CTGCTAAGTGGCCCGACTTCAGG - Intergenic
1125733857 15:41910035-41910057 CCGGAATGTGGCCAGACTTGGGG + Intronic
1125968128 15:43890666-43890688 CAGTGAAGTGGGCCGACTTGAGG + Intronic
1127847964 15:62887920-62887942 CAACAGGGAGGCCTGACTTGAGG - Intergenic
1128447734 15:67779169-67779191 CAGCAAGGGGGCCCCACGTAGGG + Intronic
1128608531 15:69056168-69056190 CAGCAGGGTGGCCAGCCCTGGGG + Intronic
1131373683 15:91905929-91905951 CAGCAAGGTGGCCCGACTTGGGG - Intronic
1133111219 16:3549400-3549422 CAGCCAGGTGCCCCCACTTTAGG + Intronic
1134505522 16:14802830-14802852 CACCATGTTGGCCAGACTTGAGG - Intronic
1134575058 16:15326080-15326102 CATCATGTTGGCCAGACTTGAGG + Intergenic
1134727386 16:16430412-16430434 CATCATGTTGGCCAGACTTGAGG - Intergenic
1134940048 16:18281443-18281465 CATCACGTTGGCCAGACTTGAGG + Intergenic
1152668108 17:81583514-81583536 CAGCCAGGTGGCAGGACGTGGGG - Intronic
1155192976 18:23447698-23447720 CAGCAAGATGGCAGGACTTGAGG - Intergenic
1161629358 19:5344507-5344529 CAGCAAGGAGGCCCGAGTGGCGG - Intergenic
1162389600 19:10381212-10381234 CAGCAAATGGGCACGACTTGCGG - Intergenic
1168309881 19:55455087-55455109 CAGCCAGGTGGACCGGCTGGTGG - Exonic
927673018 2:25084713-25084735 CAGAAAGGTGGGACAACTTGAGG + Intronic
928203055 2:29263469-29263491 TAGAAAGGTGTCCCGACTTCTGG + Intronic
1173627242 20:44482209-44482231 CAGCAAGCTGGCACAATTTGGGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174398140 20:50260624-50260646 TAACAAGGTGACCTGACTTGGGG - Intergenic
1175246760 20:57586728-57586750 CAGCAGGGTGGCCTGCCTTGGGG - Intergenic
1180223087 21:46371696-46371718 CAGCAAGGTCTCCCCACTTGTGG + Intronic
1182299445 22:29329565-29329587 CAGCCAGGTGGCCCTGATTGAGG - Intronic
1183660325 22:39216248-39216270 CTGCAAGGTGGCTCGCCGTGTGG - Intergenic
1184059913 22:42075201-42075223 CACCAAGGTGGCCTGACCTAAGG - Intronic
1184161763 22:42701250-42701272 CAGAGAGGTGGCCTGTCTTGTGG - Intronic
1184451495 22:44585465-44585487 CAGGAAGGAGGACAGACTTGGGG + Intergenic
1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG + Intronic
1185041032 22:48504511-48504533 CAGCAAGGTGCCCGGACTCACGG - Intronic
1185201147 22:49506239-49506261 CAGCATGGTGGCCCCCCTTTGGG - Intronic
951770868 3:26256374-26256396 TAGCAAGGTGTCCTTACTTGTGG - Intergenic
953850179 3:46459965-46459987 CAGCAAGATGCCTCCACTTGTGG - Intronic
960147041 3:114214545-114214567 AAGCAAGTTGGCCAGACCTGAGG - Intergenic
963341142 3:144035273-144035295 CAGCCAGCAGGCCCAACTTGAGG - Intronic
969703411 4:8779935-8779957 CAGCAGGGTGGCTTGACTCGGGG + Intergenic
979189237 4:117835692-117835714 CAGCTGGGTGGCCCGACTCCAGG - Intergenic
982349052 4:154394695-154394717 CAGCAACTTGGCCCAATTTGAGG - Intronic
986936044 5:12888081-12888103 CAGAATGTTGGCCAGACTTGAGG + Intergenic
988642368 5:33055157-33055179 GAGCAAAGTGGCTCTACTTGAGG + Intergenic
994820607 5:104646106-104646128 CAGCAAGGTTGGCAGACTTGAGG + Intergenic
995124049 5:108562527-108562549 CAGAAAGGTGGAACAACTTGAGG - Intergenic
1003005853 6:2380780-2380802 GAGCAATGTGGCCCAGCTTGTGG + Intergenic
1005682471 6:28220289-28220311 CTGCAAGGTGGCCAGACTACAGG + Intergenic
1005763237 6:28986840-28986862 GAGCAAGATGGCCGAACTTGAGG - Intergenic
1010306388 6:74327943-74327965 CAGCAATGTGGCCCTTCTTTGGG - Intergenic
1011536270 6:88379674-88379696 CAGCAAGGTGGCAGGTTTTGCGG + Intergenic
1013950240 6:115771379-115771401 CAGAAAGGTGGCTCGACTTCAGG - Intergenic
1017778552 6:157698541-157698563 CAGGAAGGTGGGACAACTTGAGG + Intergenic
1021147926 7:17111848-17111870 CAGAAAGGGGGCACCACTTGAGG - Intergenic
1022537390 7:31106645-31106667 CAGCAGGGAGGCCAGACATGCGG - Exonic
1028473716 7:91231697-91231719 CAGCAGGGGGGCCTGACCTGGGG + Intergenic
1038266249 8:26041717-26041739 GAGCCAGGTGGCCTGAGTTGCGG - Intronic
1040944414 8:52868684-52868706 CAGAAAGGTGGGACAACTTGAGG + Intergenic
1041713021 8:60910313-60910335 CCGCCAGGTGGCCCAACTTAGGG - Intergenic
1058890537 9:109357055-109357077 CAGCAAGGTGGCAGGGCTTGGGG - Intergenic
1061676010 9:132216048-132216070 CAGGAAGGTGACCAGCCTTGGGG - Intronic
1185800935 X:3010104-3010126 CAGGAAGGCAGCCCGACTTGGGG - Exonic
1185820704 X:3200943-3200965 CAGCTAGGTGGCCCCGCTTATGG - Intergenic
1186428790 X:9486612-9486634 CAGAAAGGTGGGAAGACTTGAGG - Intronic
1188335584 X:28928233-28928255 CAGAAAAGTGGCCAGATTTGGGG - Intronic
1190298177 X:49040686-49040708 CAGCAAGGTGGCCAAATATGAGG - Intronic