ID: 1131375011

View in Genome Browser
Species Human (GRCh38)
Location 15:91916133-91916155
Sequence CGATGCCGCCGCAGCCGATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131375011_1131375015 4 Left 1131375011 15:91916133-91916155 CCTGATCGGCTGCGGCGGCATCG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1131375015 15:91916160-91916182 GGCGCTGGGCGCGCTGCTGTCGG 0: 1
1: 0
2: 2
3: 23
4: 193
1131375011_1131375014 -10 Left 1131375011 15:91916133-91916155 CCTGATCGGCTGCGGCGGCATCG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1131375014 15:91916146-91916168 GGCGGCATCGTCATGGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131375011 Original CRISPR CGATGCCGCCGCAGCCGATC AGG (reversed) Exonic
902212558 1:14914206-14914228 AGATGCTGCTGCAGCTGATCAGG + Intronic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905862636 1:41361483-41361505 TGCTGCCGCCGCCGCCGCTCCGG - Intergenic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
921472610 1:215567373-215567395 CGACGCCGCCGCAGCCTGCCTGG - Exonic
1062833281 10:620117-620139 GGAGGACGCCACAGCCGATCTGG + Intronic
1071052822 10:81472871-81472893 TGATGCAGCAGCAGCCCATCTGG + Intergenic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1098161421 12:67649924-67649946 CGCTGCCGCCGCAGCCCACACGG + Exonic
1104854366 12:131895061-131895083 CGAAGGCGCCGTGGCCGATCAGG - Exonic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1123451031 15:20358743-20358765 CGAAGCCGCCGCTGCAGATGAGG + Intergenic
1129387298 15:75202882-75202904 GGCTGCCGCCGCACCCGACCTGG - Intronic
1131375011 15:91916133-91916155 CGATGCCGCCGCAGCCGATCAGG - Exonic
1131735471 15:95326950-95326972 CGCAGCCGCCGCGGCCAATCCGG - Intergenic
1132055465 15:98648198-98648220 CAATGCCCCCGCCGCCGGTCCGG - Intergenic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1142283451 16:89161063-89161085 GGATGCCGCCACAGCCCACCTGG - Intergenic
1144109804 17:12020901-12020923 CGGAGCCGCCGCCGCCGCTCGGG - Exonic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1147393328 17:40122822-40122844 CCTTGCCGCCGCAGCCGGCCGGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1161701680 19:5799348-5799370 CGATGCTGCCGCGGCCGCCCCGG + Intergenic
1161877942 19:6926362-6926384 CGATGATGGCGCAGCCCATCTGG - Exonic
1166790616 19:45396572-45396594 CGCTGCCGCCGGAGCCTAGCAGG + Exonic
945431725 2:209772234-209772256 CGCTGCCGCCGCCGCCGCTGAGG + Intronic
1168786375 20:543503-543525 CGAGGCCCCTGCAGCCCATCGGG - Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1172666646 20:36605061-36605083 CGATACGGCCGCTGCTGATCCGG + Intronic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1183942257 22:41302305-41302327 CGTGGCCGCCGCAGCCGAAAGGG - Intronic
953891663 3:46755847-46755869 TGTTGCCGCCGCCGCCGATCTGG - Intronic
969330715 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG + Intronic
975118592 4:70705254-70705276 TGCTGCCGCCGCCGCCGCTCGGG - Intronic
982712275 4:158769191-158769213 TGATGCCGCCGCCGCAGCTCCGG - Exonic
983904439 4:173169215-173169237 CGCTGCCGCGGCAGCGGCTCGGG + Intronic
983904499 4:173169415-173169437 CGATGCCGCCACCGCTGGTCCGG + Intronic
985552025 5:538587-538609 CGATGCCGCCTCAGCCGCCCAGG + Intergenic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
993900909 5:93584070-93584092 CGAGGCTGCCGCCGGCGATCAGG - Exonic
1002898101 6:1390664-1390686 CGAGGCCGCCGTAGCCGCCCTGG - Exonic
1004255343 6:14058257-14058279 CGATGCTGAAGCAGCCGGTCTGG - Intergenic
1013155827 6:107490357-107490379 GGATGCCGCCGCCGTCGCTCCGG - Exonic
1018156654 6:160991711-160991733 CGCCGCCACCGCCGCCGATCTGG + Intronic
1022476280 7:30712533-30712555 TGATGCCGCTGCTGCTGATCTGG - Intronic
1024394267 7:48848084-48848106 GGAGGCGGCCGCAGCCGGTCAGG + Intergenic
1029996494 7:105012999-105013021 CGTTGCTGCCGCGGCCGATATGG - Intergenic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1185892766 X:3835468-3835490 TGCTGCCGCCGCGGCCCATCAGG - Intronic
1185897874 X:3873888-3873910 TGCTGCCGCCGCGGCCCATCAGG - Intergenic
1185902993 X:3912319-3912341 TGCTGCCGCCGCGGCCCATCAGG - Intergenic
1186660563 X:11664684-11664706 CGCTCCCGCAGCCGCCGATCAGG + Exonic