ID: 1131377085

View in Genome Browser
Species Human (GRCh38)
Location 15:91934392-91934414
Sequence GTAGAAGCACAGAGACCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131377082_1131377085 -10 Left 1131377082 15:91934379-91934401 CCCAGCAAGACATGTAGAAGCAC 0: 1
1: 0
2: 5
3: 14
4: 153
Right 1131377085 15:91934392-91934414 GTAGAAGCACAGAGACCCATGGG 0: 1
1: 1
2: 3
3: 20
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131377085 Original CRISPR GTAGAAGCACAGAGACCCAT GGG Intronic
904678447 1:32212686-32212708 GTCAAAGCACACAGACCCAGAGG - Intronic
905838585 1:41152697-41152719 GGAGCAGCACAGAGCCCCTTTGG + Exonic
907692430 1:56682692-56682714 GTAGAAGCAGACAGACCAGTTGG + Intronic
908077437 1:60535834-60535856 GTGGATGGACAGAGAGCCATAGG + Intergenic
911384526 1:97158180-97158202 GTAGAAGCACAAAAAGCCCTGGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913182064 1:116331632-116331654 GCAGATGCCCAGAGACCCAATGG - Intergenic
915287173 1:154860486-154860508 GTAGAATAACAGGGCCCCATGGG + Intronic
916262435 1:162855645-162855667 GCAGAAGCACAGAGCCCCACAGG - Exonic
917851016 1:179064045-179064067 GCAGAAGCACCGTCACCCATGGG + Exonic
919482041 1:198101930-198101952 GCAGAACCACAGAGAAGCATTGG + Intergenic
920633782 1:207678936-207678958 ATAGGAGGACAGAGACCCAGAGG - Intronic
920819456 1:209366761-209366783 TCAGAAGCACAAAGAACCATGGG + Intergenic
920833615 1:209487549-209487571 GAAGAGTCTCAGAGACCCATAGG + Intergenic
922177944 1:223211548-223211570 GGAGAAGAACAGTGACTCATGGG + Intergenic
922847316 1:228697352-228697374 AGACAAGCACAGAGACCCAGAGG + Intergenic
923856466 1:237850295-237850317 CTAGAAGCACAGAGAAGCATAGG + Intergenic
924062807 1:240193761-240193783 CTGGAAGCAGAGAGACCCATCGG - Intronic
1063741271 10:8822934-8822956 GTAGAAGCACACAGACCACCTGG + Intergenic
1064510546 10:16085491-16085513 CTATAAGAAAAGAGACCCATGGG + Intergenic
1064778334 10:18805069-18805091 GTAGAAGCACTCAGATGCATGGG - Intergenic
1067355247 10:45518270-45518292 GTAGAATCACAGATACTCAGGGG - Intronic
1067935618 10:50609996-50610018 GGAGGAGCACAGAGGCCCCTTGG - Intronic
1068389684 10:56378527-56378549 GTAGAAGCCAAGAGACCTAAGGG - Intergenic
1068548504 10:58379938-58379960 GTAGGAGCACAGAGAATGATGGG - Intergenic
1070652497 10:78247928-78247950 GTAGCACCACAGAGACCAATGGG - Intergenic
1074142409 10:110685570-110685592 GAAGAAGCAGAGAGACCTTTGGG + Intronic
1074446580 10:113525814-113525836 TTGGAAGCTCAGAGACCCATGGG + Intergenic
1075964274 10:126597596-126597618 GTAGAAGCTGAGAGACCAAATGG + Intronic
1076013835 10:127012174-127012196 AAAGGGGCACAGAGACCCATGGG - Intronic
1077176491 11:1193460-1193482 GCAGAAGCACAGAGACCTGCAGG - Intronic
1078396790 11:10988592-10988614 TTAGAGGCACAGAGAACAATTGG + Intergenic
1079298616 11:19257323-19257345 GTGGAAGCACAAAGAATCATTGG + Intergenic
1079601166 11:22314759-22314781 TTAGGAGTACAGAGACCCAATGG - Intergenic
1084434530 11:69131210-69131232 CTAGATGCACAGACACCCAGAGG - Intergenic
1085793283 11:79514735-79514757 TTAGGGCCACAGAGACCCATAGG + Intergenic
1086720276 11:90112039-90112061 GTTAAACCACAGAGACCCAGGGG - Intergenic
1086856354 11:91870885-91870907 GGAGAAACAAAGGGACCCATTGG + Intergenic
1087711862 11:101563256-101563278 GAAGAATAACAGAGACCCAAGGG + Intronic
1087749371 11:101990131-101990153 GTAGAACCACTGGGAGCCATAGG + Intronic
1089213004 11:116819192-116819214 CTAGAAGCACAGGAACCTATGGG - Intergenic
1092322434 12:7491350-7491372 ATATAAGCAAAGCGACCCATAGG - Intronic
1093773811 12:23049007-23049029 ATAGAAGCATAGAGACCCATAGG - Intergenic
1099018937 12:77379684-77379706 GTAGAAGCACAGACACTGAAGGG - Intergenic
1101187353 12:102293034-102293056 GTAGAACCACCTAGACCCAAAGG + Intergenic
1101491167 12:105210969-105210991 GTAGCAGGACAGAGACGCACAGG - Intronic
1104615384 12:130263892-130263914 TTAGAACCACAGAAACCCACTGG + Intergenic
1107798481 13:44079926-44079948 GTAGAAGCAGAGAGACTGATGGG + Intergenic
1107799171 13:44088062-44088084 GTAGAAGCAGAGAGACTGATGGG - Intergenic
1108181257 13:47842020-47842042 GGAGAGGCACACAGACCCCTGGG - Intergenic
1112092000 13:96091580-96091602 GGGGAAGAACAGAGACCCAGCGG - Intronic
1112663896 13:101545319-101545341 ATAGATGCACACAGGCCCATTGG + Intronic
1114384456 14:22241063-22241085 GTAGGAGTACAGAAACCCAACGG + Intergenic
1114891876 14:26935162-26935184 GTAGAAGAACAAAGCCCCACTGG + Intergenic
1116014068 14:39385791-39385813 ATAGAAGCACTGAGAACCAGAGG - Intronic
1122417553 14:101557649-101557671 CTTGAAGCACAGAGACCCTCCGG - Intergenic
1124620309 15:31270268-31270290 GTAGAAGCCAAGAGATCCCTGGG + Intergenic
1127282188 15:57501892-57501914 CTAGACACACAGACACCCATGGG - Intronic
1130064717 15:80594190-80594212 CAAGAAGCACAGAGACACAGAGG + Exonic
1131377085 15:91934392-91934414 GTAGAAGCACAGAGACCCATGGG + Intronic
1132936634 16:2484500-2484522 GTAGAAGCAGAGAGGCCCCGGGG - Intronic
1133034845 16:3028867-3028889 GGAGAAGCAGGGAGGCCCATTGG - Intronic
1134504040 16:14790959-14790981 GGAGACAAACAGAGACCCATTGG + Intronic
1134576532 16:15337949-15337971 GGAGACAAACAGAGACCCATTGG - Intergenic
1134725911 16:16418550-16418572 GGAGACAAACAGAGACCCATTGG + Intergenic
1134780378 16:16889895-16889917 GAAGAAACACAGAGACACATAGG - Intergenic
1134941523 16:18293309-18293331 GGAGACAAACAGAGACCCATTGG - Intergenic
1135203299 16:20459476-20459498 CTAGCAACACACAGACCCATAGG - Intronic
1135215704 16:20565462-20565484 CTAGCAACACACAGACCCATAGG + Intronic
1136456290 16:30381620-30381642 CAAGAAGCACAGGGACCCAGTGG + Intronic
1141793898 16:86256566-86256588 GTAGAGGCTCAGCTACCCATTGG + Intergenic
1142275680 16:89117697-89117719 ATAGTAGCCCAGAGACCCAGGGG + Intronic
1142432984 16:90040589-90040611 GGATAGGCACAGAGACCCCTCGG + Intronic
1146516850 17:33496156-33496178 GCAGAAGAACAGAAAGCCATGGG + Intronic
1149273941 17:55014046-55014068 TTAGGAGCACAGAAACCCAGTGG - Intronic
1151382682 17:73736473-73736495 GCAGAAGCCCTGAGACCTATGGG + Intergenic
1151444347 17:74153463-74153485 CTAGAAGCACAGAGTTCCCTAGG + Intergenic
1156475567 18:37403425-37403447 GGAGGAGCACAGAGAGCCACAGG - Intronic
1157797045 18:50584260-50584282 GAAGAATCACACAGACCTATGGG + Intronic
1159414419 18:68125477-68125499 GTAGAATCAAAGTGACCCATGGG + Intergenic
1161883313 19:6972948-6972970 ATAGAAGCAAAGAGAGGCATTGG + Intergenic
1164015501 19:21253276-21253298 AAAGAATCACAGAGACCAATGGG - Intronic
1164250872 19:23473826-23473848 GTAGAATCAGTGAGAGCCATGGG - Intergenic
1165395535 19:35561674-35561696 ATAGAAGCACAGAGACAGAGAGG - Intronic
1165603570 19:37079400-37079422 GGAGGAGCACAGAGCCACATGGG - Intronic
1166571766 19:43801698-43801720 ACACAAGCACAGAGACTCATAGG + Intronic
1167172025 19:47839687-47839709 ATAGGAGCTCGGAGACCCATAGG - Exonic
1167330441 19:48852462-48852484 GTCCAAGCAAAGAGGCCCATGGG - Intronic
1167409162 19:49334947-49334969 GCAGGAGGACAGAGACCCAGAGG + Intergenic
925307222 2:2857097-2857119 GTAGAAGCACAGCATCCCTTCGG - Intergenic
925765347 2:7229034-7229056 GCAGAAACATAAAGACCCATTGG - Intergenic
926720072 2:15953377-15953399 GTCGAAGCACACAGACCTATTGG + Intergenic
927943812 2:27122716-27122738 GTAGAAGCAGAGAGGCCACTGGG - Intergenic
929744913 2:44646899-44646921 GGAGAAGAGCACAGACCCATTGG - Intronic
930226296 2:48797555-48797577 ATAGGAGCACAGAGATCCAGAGG - Intergenic
930604602 2:53480382-53480404 GTAGTAGCAGAGAGATCCACTGG - Intergenic
932401872 2:71486304-71486326 CTAGAAGCAGAGAGAGCCAGAGG - Intronic
932885250 2:75543471-75543493 GAACAAGCACAGGGACCCAGAGG + Intronic
934658477 2:96130342-96130364 GTAGAGGCACAGGGACCCCATGG + Intronic
935418220 2:102841042-102841064 GCAGGATCACAGAGATCCATGGG + Intronic
937077149 2:119115339-119115361 GGAGAAGCACAGACAACCATGGG - Intergenic
938745194 2:134271266-134271288 GTTCAAGCACAAAGACCCAGGGG - Intronic
939114448 2:138044388-138044410 GTAGAAGCAGAGAGAGCCATTGG + Intergenic
945385892 2:209200645-209200667 GTAGAAGCCCTAAGAGCCATAGG - Intergenic
945762916 2:213936475-213936497 GTAAAAGCAGAAAGACCAATTGG + Intronic
946082039 2:217128989-217129011 GCATAAGCATAGAGACCCAAAGG - Intergenic
946228005 2:218274911-218274933 ATTGAAGCAAGGAGACCCATGGG + Exonic
948305949 2:236946881-236946903 GTAGAAGCACATATGTCCATCGG + Intergenic
1169255372 20:4092745-4092767 GTGGAAGCAGAAAGACCCATAGG - Intergenic
1169440710 20:5631735-5631757 GAAGAAACACAGAGACACACAGG - Intergenic
1170643550 20:18176887-18176909 GTGGGAGCAGAGAGACCAATGGG + Intronic
1173265136 20:41472304-41472326 GAAGAAGCCCAGACACCCATTGG + Intronic
1174785865 20:53431892-53431914 GTAACAGCACACAGAACCATGGG - Intronic
1176060914 20:63172631-63172653 GGAGAGACACAGAGACCCAGGGG + Intergenic
1177751707 21:25293059-25293081 GTAGAAGCAAGGAGATCCACTGG - Intergenic
1178806791 21:35846046-35846068 GCAGAAGCACTGATTCCCATGGG + Intronic
1179362717 21:40727660-40727682 GTAGAAGCAGAGAGACCCATTGG - Intronic
1180170720 21:46056896-46056918 GCAGCAGCACAGAGACCCCCGGG - Intergenic
1181808058 22:25386907-25386929 GCCGTATCACAGAGACCCATGGG - Intronic
1182057200 22:27368965-27368987 GCAGAATCACAGAGAAGCATAGG - Intergenic
1184976275 22:48064568-48064590 CCAGGAGCACAGTGACCCATTGG - Intergenic
949776329 3:7636705-7636727 GTAGATGCAGAGAGAACCCTAGG + Intronic
949954691 3:9258149-9258171 GGAGAAGCACAGGGTCCCATGGG + Intronic
951439368 3:22705713-22705735 GTAACAGAACAGAGCCCCATAGG - Intergenic
953138720 3:40207247-40207269 GTAGAAGCAGCAAGACCAATAGG - Intronic
955342836 3:58138687-58138709 CTAGAAACTCAGAGACCCTTTGG + Intronic
955866670 3:63391285-63391307 TTAGAGTCACAGAGACACATTGG - Intronic
958174664 3:89981542-89981564 GTAGAAGGACAAAGACCTAGTGG + Intergenic
960162578 3:114366671-114366693 GTAGAATTCCAGAGACACATGGG - Intronic
960543108 3:118882189-118882211 TGAGAAGCACAGAGACACACAGG - Intergenic
963005451 3:140722760-140722782 GTAGAGGAACTGAGACCCCTTGG + Intergenic
964409120 3:156379796-156379818 TTAGAGGCACAGAGACTCTTGGG + Intronic
969160829 4:5257517-5257539 GTAGAAGCAAGAAGACCCATAGG - Intronic
969376942 4:6769207-6769229 CTAGAATCACGGAGACCCAATGG - Intergenic
969929192 4:10613656-10613678 GTGGAAGCAGAGAGACCCTTTGG + Intronic
971054051 4:22892827-22892849 GTAGAAGAACAGAAGCCTATGGG - Intergenic
973755549 4:54069994-54070016 GGAGAAGCACAGGGGTCCATGGG + Intronic
974176350 4:58330390-58330412 GTAGAAGCATAGAAAAACATGGG + Intergenic
978066918 4:104416599-104416621 GTACATGCACAGAGACACAAAGG + Intergenic
978715852 4:111841481-111841503 GAAGAAGCACAAATACCCCTGGG + Intergenic
979557963 4:122072533-122072555 GTAGAAGCAGGGAGACCAGTTGG + Intergenic
979981315 4:127258717-127258739 GTAGGAGCAAGGAGACCAATAGG - Intergenic
980955180 4:139420920-139420942 GTAGAATCTCAGAGACCTCTCGG + Intergenic
982131055 4:152228965-152228987 GGACAAGCACAAAGACCCCTGGG + Intergenic
985627945 5:999782-999804 GGAGAATCCCAGAGACCCACTGG + Intergenic
986920667 5:12675639-12675661 GTAGAATCACAAAGGCCCTTTGG - Intergenic
990004623 5:50931688-50931710 GGAGAAGCACGCAGACACATAGG + Intergenic
991253000 5:64584601-64584623 TAAGAAGCACAGAGCCCCCTTGG - Intronic
992348257 5:75902466-75902488 GTTGAAGCACAGAAACCTAGAGG - Intergenic
993123839 5:83807593-83807615 GTACAAAGACAGAGACCCAGAGG - Intergenic
993355339 5:86899803-86899825 GTGGAAGCAAAGGGATCCATTGG - Intergenic
998178618 5:139918848-139918870 GCAGAAGCAGAGAGATTCATGGG + Intronic
998373637 5:141677594-141677616 GGAGAAGCAGAGAGACCAGTGGG - Intronic
998513346 5:142731946-142731968 GTTGATGCCCAGAGACCCAAAGG - Intergenic
999133656 5:149302782-149302804 GTGGAAGCACAGAGATCCAGAGG - Intronic
999588545 5:153118061-153118083 CTAGAAGCAGACAGACCCTTAGG - Intergenic
1000641871 5:163712479-163712501 GAAGAAGTAGAGAGACCAATTGG + Intergenic
1005988015 6:30886078-30886100 GGAGAAGCACAGAGACGTCTGGG - Intronic
1006641372 6:35491434-35491456 GGACAAGGACAGAGACCCAGAGG + Intronic
1011362765 6:86546186-86546208 GTAGACACACATAGACCAATAGG - Intergenic
1011598640 6:89039986-89040008 GTGGGAGCAAAGAGACCAATTGG - Intergenic
1014198438 6:118583782-118583804 TTAGGAGCACAGAAACCCAATGG + Intronic
1014552057 6:122800573-122800595 GCAAAAGCACAGAGTTCCATAGG - Intronic
1014718078 6:124888699-124888721 GGAAAAACACAGAGAACCATGGG - Intergenic
1015156211 6:130099234-130099256 GCAGAAGAACAGAGTCCCATAGG - Intronic
1015907053 6:138128333-138128355 GTAGACACACAGACACCCACAGG - Intergenic
1016474817 6:144415766-144415788 GTAGAAGCAAAGAGATCAGTTGG + Intronic
1016908385 6:149173463-149173485 ATAGAAGCACAGAGACACATAGG + Intergenic
1019793554 7:3033253-3033275 CTGGAGGCACAGAGACCCAGGGG + Intronic
1023859023 7:44206005-44206027 GGAGCAGCACAGAGCCCCAAGGG + Intronic
1025075301 7:55937402-55937424 GTAGAGGCAGAGAGACTCATTGG + Intronic
1030161081 7:106509122-106509144 GAAGAGGCACTGAGACCCTTGGG - Intergenic
1032522570 7:132557061-132557083 GGAGAAGCTTAGAGACCCACTGG + Intronic
1032785552 7:135196948-135196970 GAAGAAAGACAGAGACCCAAGGG + Intronic
1034986798 7:155521217-155521239 CTACAATCACAGAGCCCCATCGG - Intronic
1038238171 8:25782347-25782369 ATAAAAGCAGAGAGACCAATGGG - Intergenic
1038333749 8:26630118-26630140 GTACAAGCACAGACACGCATAGG + Intronic
1039039795 8:33396166-33396188 GTAGAGCCTCAGAGACCCACTGG + Intronic
1040307624 8:46220425-46220447 GGAGAAGCAGAGAGACCCCAGGG + Intergenic
1040891653 8:52323680-52323702 CTAGAAGCTCAGAGACTGATGGG - Intronic
1041508935 8:58633021-58633043 GTGGAAGCAAGGAGACCTATTGG - Intronic
1043001250 8:74762768-74762790 GTAGAAGCACAGCTACACACTGG - Intronic
1043504729 8:80891102-80891124 GTAGCACCACAGAAAGCCATAGG + Intergenic
1045268069 8:100637618-100637640 GTAGAAGCAGAGAGACTTGTTGG - Intronic
1045611561 8:103848655-103848677 GTAGAACAACATAAACCCATAGG - Intronic
1046817599 8:118601815-118601837 GTAGAAGCAGAGAGAAACAGAGG + Intronic
1048834465 8:138505026-138505048 GTAGAATCAAAGGGACCCAGTGG + Intergenic
1049201887 8:141344314-141344336 GTGGAAGCACAGAGGCACAGGGG - Intergenic
1051564417 9:18480982-18481004 ATAGAAGCACACAGATCCAAGGG + Intronic
1052138963 9:24954137-24954159 CAAGATGCACAGAGACTCATGGG + Intergenic
1053011331 9:34635460-34635482 ATCCAAACACAGAGACCCATGGG - Exonic
1058977997 9:110142548-110142570 AGAGAAGCACAGAGACCTGTAGG + Intronic
1059904838 9:118971113-118971135 GAAGAACAACAGAGAGCCATTGG + Intergenic
1060875335 9:127079193-127079215 GGAGAAGCACATTGACTCATGGG + Intronic
1060987067 9:127825838-127825860 GCAGAAGGACAGTGACCCCTGGG + Exonic
1061884937 9:133586673-133586695 TTAAGAGCACAGAGACCCCTGGG - Intergenic
1062402930 9:136380309-136380331 CTGGAAGCACAGAGGCCCAGGGG + Intronic
1062637367 9:137498635-137498657 GCAGAGGCTGAGAGACCCATGGG + Intronic
1186346398 X:8697459-8697481 GTGGAAGCTAGGAGACCCATCGG + Intronic
1188022499 X:25174082-25174104 GTAGGAGCACAGAGAGCAAAGGG - Intergenic
1188612182 X:32114300-32114322 GTTGAGGCACAGAGACAAATTGG - Intronic
1191031434 X:55977812-55977834 GTAGAAGCAGGGAGACCTTTTGG + Intergenic
1192387901 X:70692240-70692262 AAAAAAGCACAGAGACCCAAGGG - Intronic
1192554906 X:72081577-72081599 GTGGAAGCAGGGAGCCCCATAGG - Intergenic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1194079123 X:89435857-89435879 GTAAGAGCACAGAGACCCCATGG - Intergenic
1194736922 X:97523261-97523283 ATAGAAGCAGATAGACTCATGGG + Intronic
1196387097 X:115168732-115168754 ATAGAAGCACAGGGACCAGTTGG - Intronic
1199941275 X:152630274-152630296 GCAGAAGCACAGAGAGCAGTCGG - Intergenic
1200706493 Y:6447293-6447315 GTAGAACCACAGAGCCTCAGGGG - Intergenic
1201027619 Y:9717415-9717437 GTAGAACCACAGAGCCTCAGGGG + Intergenic
1201192678 Y:11459977-11459999 GTTAAACCACAGAGACCCAGGGG - Intergenic