ID: 1131379063

View in Genome Browser
Species Human (GRCh38)
Location 15:91948865-91948887
Sequence GTTATTAAAGGAATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131379063_1131379071 16 Left 1131379063 15:91948865-91948887 CCATCCTCAATTCCTTTAATAAC 0: 1
1: 0
2: 3
3: 23
4: 348
Right 1131379071 15:91948904-91948926 CCATTTAGGAATCAATACTTTGG 0: 1
1: 0
2: 1
3: 11
4: 166
1131379063_1131379068 2 Left 1131379063 15:91948865-91948887 CCATCCTCAATTCCTTTAATAAC 0: 1
1: 0
2: 3
3: 23
4: 348
Right 1131379068 15:91948890-91948912 GAGGAACCTGTCATCCATTTAGG 0: 1
1: 0
2: 0
3: 2
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131379063 Original CRISPR GTTATTAAAGGAATTGAGGA TGG (reversed) Intronic
901248964 1:7758283-7758305 GGCATTAAAGAAATTGAGGTTGG - Intronic
901945426 1:12699211-12699233 GTTAGTAAATGAATACAGGAAGG - Intergenic
903513264 1:23892386-23892408 TTTATTAAAGGAATTGACTCAGG - Intronic
907005903 1:50912802-50912824 GTTATTTAAGAAACTGAGAATGG - Intronic
907227792 1:52965530-52965552 ATGATTAAAGGAATTAAAGAAGG - Intronic
908384208 1:63625629-63625651 GGTATTAAAGAAAATGAGAAAGG - Intronic
909895265 1:81061325-81061347 GTAAGTAAAGGAATTGGGAAGGG - Intergenic
911441835 1:97936748-97936770 TTTAAGAAAGAAATTGAGGAGGG - Intergenic
913203726 1:116517000-116517022 GTGATGAAAGGAACAGAGGAAGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915893462 1:159792396-159792418 GTTATTAAAGGAGCAGAGGTGGG - Intergenic
916116767 1:161491445-161491467 GTTTTTAAATTAATTGAGCAAGG - Intergenic
916822924 1:168417233-168417255 GTTAAAAAAGGATTTGAGGATGG + Intergenic
918621262 1:186608624-186608646 GGTATTGCAGTAATTGAGGAAGG + Intergenic
918861796 1:189837372-189837394 ATAATTAAAGGCATGGAGGATGG - Intergenic
918942766 1:191023830-191023852 GTTATTATAGAAAATGAGAAAGG + Intergenic
918987568 1:191652314-191652336 GTTGTTCCAGGAATTGAGGATGG - Intergenic
921410340 1:214829732-214829754 CTTATAAAAGAGATTGAGGAGGG - Intergenic
921690940 1:218149134-218149156 CTTATTAAACGAATTTAGCAAGG + Intergenic
921831140 1:219729010-219729032 CTCTTTAAAGCAATTGAGGATGG + Intronic
924008115 1:239634742-239634764 GTTATACAAGGCATTGAGTAAGG + Intronic
924088145 1:240475637-240475659 GTTAATAAAGGAATTAATGAGGG - Intergenic
1062981910 10:1731296-1731318 GATTTAAAAGGAATGGAGGACGG - Intronic
1065455094 10:25898946-25898968 GTTTTTAAAGGCAGTGAGGCAGG + Intergenic
1067095863 10:43299351-43299373 GTTTTTAAATTAATTGAGCAAGG + Intergenic
1067150715 10:43730631-43730653 GTTAGTGAAGGAATATAGGAGGG - Intergenic
1068859154 10:61829381-61829403 GTTTTTAAAGGAAAAGAAGACGG - Intergenic
1069392570 10:67951818-67951840 GTGAATGAAGGAATTGTGGAAGG - Intronic
1070909825 10:80108279-80108301 GTTTTTAAATTAATTGAGCAAGG - Intergenic
1073089556 10:100923119-100923141 GTTATTAAAGTACTTCTGGATGG + Intronic
1073165447 10:101445108-101445130 GTTATTAATGGCATTGAAGATGG + Intronic
1073313841 10:102564128-102564150 GTGAGTAAAGGAAGTCAGGAAGG + Intronic
1073762015 10:106639574-106639596 GTTGTTGAAGGAAATGAGGCAGG - Intronic
1074985700 10:118657988-118658010 GTTATTAAGCTAATTAAGGAGGG - Intergenic
1075660496 10:124192530-124192552 GTTATTAAGCGAATTAGGGAGGG - Intergenic
1077882638 11:6363427-6363449 GTAACTAAAGGACTTGAGCAGGG - Intergenic
1078641846 11:13104257-13104279 GTGAACAAAGGAATAGAGGAAGG + Intergenic
1078772092 11:14360377-14360399 TTTAAAAAAGGAATTCAGGATGG - Intronic
1078849638 11:15151848-15151870 GTTATAGAAGGAAGTGGGGAAGG - Intronic
1079270872 11:18984541-18984563 GTTTTTAAATTAATTGAGCAAGG - Intergenic
1079469650 11:20766107-20766129 GCTATTCAAGGGAGTGAGGAAGG + Intronic
1081506432 11:43721819-43721841 GTCATTGAAGGAATTGAACAGGG + Intronic
1082727373 11:56752356-56752378 GTTATTAAGAGAATTGAGATGGG + Intergenic
1083040024 11:59676622-59676644 GTTCTTAATGGCATTTAGGATGG + Intergenic
1083119219 11:60494537-60494559 TTTATAAAAGGAATTGAACAGGG - Intronic
1083872084 11:65494822-65494844 GATATTAAAGGACTAGTGGAGGG + Intergenic
1084201054 11:67558651-67558673 GTTATTTCAGGAATCAAGGAGGG + Intergenic
1084311639 11:68319859-68319881 GTTTTTAAAGATATTGAGGCCGG + Intronic
1084686588 11:70699675-70699697 GTAAATAAGGGAATTGAGAAAGG + Intronic
1085892729 11:80600140-80600162 TCTGTTAAAGGAATTGAGAATGG - Intergenic
1085895532 11:80634882-80634904 GCTCTGAAAAGAATTGAGGAAGG - Intergenic
1086187513 11:84036470-84036492 GTTAGTAATGGAATTGAGATGGG - Intronic
1087000242 11:93411301-93411323 CTTGTTAAAGTATTTGAGGAAGG + Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089864702 11:121621501-121621523 ATTACTAAAGGAAAAGAGGAGGG + Intronic
1090232320 11:125117059-125117081 GTTCTTAAAGGAAGTGAGGATGG + Intergenic
1092889011 12:12951469-12951491 GTCAGTAAAGGAAATGAGAAAGG + Intronic
1093567355 12:20623614-20623636 TTTACTAAAGGAATTTATGATGG + Intronic
1093602199 12:21041434-21041456 TTGATGAAAGAAATTGAGGAGGG - Intronic
1093769039 12:22998450-22998472 GTGAATGAAGGAATTAAGGAAGG + Intergenic
1094089262 12:26629860-26629882 GTTAAACAAGGCATTGAGGAAGG + Intronic
1094610337 12:31989491-31989513 TTTATAAAAGGAATTGACAACGG + Intronic
1095717293 12:45360380-45360402 CTTATAAAAGGAGTTGATGAGGG - Intronic
1095956674 12:47810525-47810547 GATGAAAAAGGAATTGAGGATGG - Intronic
1096733841 12:53636993-53637015 ATTATTAAAGGAAATGACAAAGG - Intronic
1097683524 12:62671136-62671158 GCTATTTAAGGAATTGAACAGGG - Intronic
1098684814 12:73405812-73405834 GTCAATAAAGGAATTGAGCTGGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1100031153 12:90193034-90193056 GTTGTAAAAGAATTTGAGGAGGG - Intergenic
1100729051 12:97443588-97443610 GTTAGGAAAGGATTTGGGGAAGG - Intergenic
1101687385 12:107038480-107038502 CTTATAAAAGAAATGGAGGAAGG + Intronic
1102104906 12:110313159-110313181 GTGATTACAGGAAATCAGGAAGG - Intronic
1102314386 12:111875117-111875139 TTTAATAAATGAATTTAGGAAGG - Intronic
1103304554 12:119953627-119953649 GATATTAATGGAAATAAGGAAGG - Intergenic
1103487377 12:121292427-121292449 CTTTTTAAAAAAATTGAGGAGGG - Intronic
1104011066 12:124930367-124930389 GTTGCTAAAGAAATTGAGAAGGG + Intergenic
1104217517 12:126748724-126748746 GCCATAAAATGAATTGAGGATGG + Intergenic
1105061884 12:133160276-133160298 CTTAATAAAGGAATTTAGCACGG + Intronic
1106161424 13:27204417-27204439 GTTAATAACGGAATGGTGGAGGG - Intergenic
1106591223 13:31100436-31100458 GTTTTTAAAGGAAATAAGGAAGG - Intergenic
1106654737 13:31731189-31731211 GATCTGAAAGGGATTGAGGAAGG - Intergenic
1107191408 13:37591547-37591569 CATATTAAAAGAATTGGGGATGG + Intronic
1108019532 13:46112960-46112982 GTTATTAGAGGAACAGAGTAAGG - Intergenic
1108603901 13:52017978-52018000 CTTTATAAAGGATTTGAGGAGGG - Intronic
1108827790 13:54436403-54436425 GTTTGTGAAGTAATTGAGGATGG - Intergenic
1108956198 13:56160968-56160990 TTGATAAAAGGAAGTGAGGAAGG + Intergenic
1108963922 13:56272571-56272593 GTTTTTAAATTAATTGAGCAAGG - Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1110028608 13:70575026-70575048 GTTATGAAGAAAATTGAGGATGG + Intergenic
1110393753 13:75006184-75006206 TTTATAAAAGAAATTGAAGAAGG + Intergenic
1110866325 13:80399881-80399903 GTTTTTAAATTAATTGAGAAAGG - Intergenic
1110893202 13:80715873-80715895 ATTATGAAAGAAATTGAGAAGGG - Intergenic
1111021024 13:82452569-82452591 ATTATAAAATGAATTGAAGAAGG + Intergenic
1111345028 13:86940444-86940466 GTCATTAAAAGAATTGTGGCCGG - Intergenic
1112706890 13:102080445-102080467 GTATTTGGAGGAATTGAGGATGG - Intronic
1112748583 13:102555500-102555522 TTCATTAAAAGAATTGAGGCAGG + Intergenic
1112870646 13:103966546-103966568 TTTGTAAAAGGAATTGAGTATGG + Intergenic
1113500036 13:110766014-110766036 GTTATTACAGGGATTGGGCATGG + Intergenic
1114397733 14:22382144-22382166 GTTATTAATGGAAATGAGTTTGG + Intergenic
1114911330 14:27201843-27201865 GTTATTAGAGGAGTTGAAGATGG - Intergenic
1115071553 14:29328797-29328819 TTTAAAAAAGGAATTGAGGCTGG - Intergenic
1116182295 14:41550462-41550484 GCCATTACAGGATTTGAGGAAGG + Intergenic
1116244341 14:42389901-42389923 GTTATAATGGGAGTTGAGGAAGG + Intergenic
1116660649 14:47706460-47706482 TTTATTAAAAGAATTGAAGCCGG + Intergenic
1117221534 14:53611419-53611441 GTTCTAAAAGGATTTGAGGCTGG + Intergenic
1118126436 14:62909652-62909674 CTTATTATAGGAATACAGGAGGG - Intronic
1118927203 14:70203273-70203295 GTTATTAAAAGAATTGAATAGGG - Intergenic
1120929372 14:89833223-89833245 GTTATTAAAGTAACTGTGGCAGG + Intronic
1121558196 14:94854413-94854435 GTTGTTACAATAATTGAGGAGGG + Intergenic
1122351605 14:101097645-101097667 GTTGTTAAAGTAAGTGAAGATGG + Intergenic
1123504234 15:20922900-20922922 TTAAATAAAGGATTTGAGGATGG - Intergenic
1123561479 15:21496597-21496619 TTAAATAAAGGATTTGAGGATGG - Intergenic
1123597723 15:21933877-21933899 TTAAATAAAGGATTTGAGGATGG - Intergenic
1126049906 15:44676083-44676105 CTTAATGAAGGAATTGAAGAGGG - Intronic
1126690477 15:51285391-51285413 GTTTTTAAATTAATTGAGCAAGG - Intronic
1127768667 15:62212501-62212523 GTTTTTAAATTAATTGAGCAAGG + Intergenic
1129054995 15:72812910-72812932 GTAATTCAAGCAAATGAGGATGG - Intergenic
1129065088 15:72895873-72895895 GTTATTAGAGGAACAGAGAAAGG + Intergenic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1130681938 15:86004697-86004719 ATCAGTAAAGGAATAGAGGAAGG + Intergenic
1131379063 15:91948865-91948887 GTTATTAAAGGAATTGAGGATGG - Intronic
1202969824 15_KI270727v1_random:223721-223743 TTAAATAAAGGATTTGAGGATGG - Intergenic
1133854548 16:9537264-9537286 TTTTTTAAAGGAAGAGAGGATGG + Intergenic
1135271249 16:21071589-21071611 GTTATTAAAGATATTTAGGCTGG + Intronic
1137645260 16:50067552-50067574 GTAATTACAGGAAGTGAGGCTGG + Intronic
1138930564 16:61650529-61650551 GTTATTTAACAAATTGAGCATGG + Exonic
1145100269 17:20069971-20069993 GCTAATAAAGGAGTTCAGGAAGG - Intronic
1146179201 17:30686592-30686614 GTTGGTAAAGAAATTGAGGAGGG - Intergenic
1146243811 17:31259376-31259398 TTAAATAAAGGATTTGAGGATGG + Intronic
1148962793 17:51407378-51407400 GTTATTAAAGGTTTTGACTAGGG - Intergenic
1149826510 17:59833826-59833848 GTTGTTTAGGGAAATGAGGAAGG - Intronic
1150022932 17:61638723-61638745 TTGATGAAAGAAATTGAGGAGGG + Intergenic
1150608365 17:66713483-66713505 GTTCTTAAATGAATTCAAGATGG - Intronic
1151071290 17:71215663-71215685 CTCATTAAAGCAATTGAGAAAGG - Intergenic
1152050758 17:77974426-77974448 GATTTTACAGGAATTGAGGTAGG - Intergenic
1155165935 18:23232526-23232548 CTTCTTAAAGCAATTAAGGATGG - Intronic
1155294270 18:24370999-24371021 TTTATTGAAGGAAGTGAAGATGG - Intronic
1156288092 18:35719459-35719481 GTTCTTAATGGAATTTAGAATGG - Intergenic
1159409083 18:68046432-68046454 GTTATTAAAATATTTGATGAAGG - Intergenic
1159689363 18:71466955-71466977 GTTAGCAGAGGATTTGAGGAAGG + Intergenic
1160068571 18:75603536-75603558 TTTATGAAAGAAATTGAAGAAGG + Intergenic
1162979423 19:14228978-14229000 GTTGGTAAAGAAATTGAGGAGGG + Intergenic
1163157307 19:15446450-15446472 GTTATTAATGGCTTAGAGGAGGG + Intronic
1164846017 19:31433154-31433176 TTTAGTAAAGGAATAAAGGAAGG + Intergenic
1165705447 19:37973058-37973080 GTTATTAAAGGAAAGGGGGGAGG + Intronic
1167874214 19:52398146-52398168 GTTACTAAAGGATTTGAAGCAGG - Intronic
925337900 2:3112002-3112024 GTAATTCAAGGAATTGAAGCTGG - Intergenic
925358019 2:3256276-3256298 GTTATTAGAGGAATTGAAGAGGG - Intronic
926984105 2:18602694-18602716 GTTTTTGAAGGAATGAAGGATGG + Intergenic
927537987 2:23879493-23879515 GCTATACAAGGAATTGAGGTAGG + Intronic
928014554 2:27643166-27643188 ATTATAAAAAAAATTGAGGAGGG - Intronic
928193582 2:29196091-29196113 GTTATTGAAGGAATGGGAGAGGG + Intronic
928487518 2:31747877-31747899 GTTATTTAAGGAAATGATGGTGG + Intergenic
928706785 2:33958039-33958061 GTGAATAAAAGAATTGAGGCCGG - Intergenic
929356669 2:41033166-41033188 GTCATTAAATGGACTGAGGATGG - Intergenic
929539185 2:42806795-42806817 GTTCTGAAAGGCATTCAGGAAGG + Intergenic
929901346 2:46006266-46006288 GTTATTAAATGAATTTTGGAAGG - Intronic
930691434 2:54369787-54369809 GTTATTAAAAGAATTCAGTGAGG + Intronic
931085777 2:58829397-58829419 GTTATTAAATGCCTTGAGGTAGG + Intergenic
931110591 2:59106586-59106608 ATTATTAAAGCAACTCAGGATGG - Intergenic
931744047 2:65276266-65276288 GTTATTAAAGCACCTGAGGGAGG - Intergenic
933142891 2:78815636-78815658 GTTAATGATGGAATTGGGGAGGG + Intergenic
933881402 2:86673585-86673607 ATGATTAAAAAAATTGAGGAGGG - Intronic
933982954 2:87568486-87568508 ATTGTTAAAGGAAAAGAGGAGGG - Intergenic
934124443 2:88873172-88873194 GTTATTAAAGAATAAGAGGAGGG - Intergenic
934920044 2:98335683-98335705 GTTATAAAAGAAATAGAGGCCGG + Intronic
935205202 2:100890929-100890951 GTAAGTAAAAGAAGTGAGGATGG + Intronic
935722406 2:105991071-105991093 GTTGTTAAAGGAATTCAAGCAGG + Intergenic
936055194 2:109257332-109257354 GGAAAGAAAGGAATTGAGGAGGG + Intronic
936310887 2:111382309-111382331 ATTGTTAAAGGAAAAGAGGAGGG + Intergenic
936498492 2:113045563-113045585 ATTTTTAAAGGAAAAGAGGATGG - Intronic
937129409 2:119496304-119496326 GTAATTTAAGGAATTGTAGATGG + Intronic
937426419 2:121802992-121803014 TTAAATAAAGGAATTAAGGATGG - Intergenic
937779280 2:125818956-125818978 GTTATTAAATGGATAGATGAAGG - Intergenic
938752972 2:134352365-134352387 GCTATAAAAAGAAATGAGGAAGG + Intronic
938940437 2:136164816-136164838 GTTATTAGATGAAGTGGGGAAGG - Intergenic
941059999 2:160836377-160836399 GTTTTTGAAGGAGTAGAGGACGG - Intergenic
941890395 2:170574939-170574961 ATTATTAAAGGGAGTGGGGAGGG - Intronic
942275846 2:174323108-174323130 GATGTTAAAGGAATTTAGTAAGG - Intergenic
942760754 2:179394685-179394707 GTCATGGAAGGAATTGGGGAAGG + Intergenic
943002596 2:182347492-182347514 GTTATTAAAGGAGATTACGAGGG - Intronic
943432746 2:187825164-187825186 TTTATTAAAGGATTTTAGCAAGG - Intergenic
943886711 2:193227755-193227777 ATGATTAAAGGAATAAAGGAAGG - Intergenic
943978561 2:194514921-194514943 GTTATGGAAAGACTTGAGGAAGG - Intergenic
945498390 2:210537387-210537409 GTTAATAAAGGATTTGTGTATGG + Intronic
946608252 2:221430129-221430151 GTGATTAAAGCCATTGAGGAAGG - Exonic
947138595 2:227000132-227000154 ATTATTAATGGAATTGAACAAGG + Intergenic
948522943 2:238552789-238552811 GTTATAAAAAGAATTAAGGCTGG + Intergenic
948780639 2:240319624-240319646 CTTGTTAAAGGAATTGACGTGGG + Intergenic
1170245639 20:14219485-14219507 GTTATTAAGCTAATTGGGGAGGG - Intronic
1170335012 20:15260280-15260302 GCTATGAAAGGAAGTGGGGAGGG - Intronic
1171277850 20:23873905-23873927 GTTATCACAGGATTGGAGGAAGG - Intergenic
1172315662 20:33952201-33952223 GTTATAAAAAGAAATGAGGCTGG + Intergenic
1174150107 20:48480447-48480469 GATATTAAAGGACTTTAGGGAGG - Intergenic
1174952694 20:55060163-55060185 TTTACTAATGGAATAGAGGAAGG + Intergenic
1175720177 20:61281022-61281044 GTTATTAAAGGAAACTAGGAGGG + Intronic
1177056203 21:16305197-16305219 GTTATTTAAGCAAATGATGATGG + Intergenic
1177842918 21:26254623-26254645 GTTATTGAAGGAATTGTTGAAGG + Intergenic
1180624099 22:17182448-17182470 GTTAGTAAAGTTATTCAGGAGGG - Intronic
1184107701 22:42377947-42377969 GTTGTTAAAAGAATGAAGGATGG + Intergenic
949741149 3:7236104-7236126 CTTATAAAAGGACTTGAGGAGGG - Intronic
950169468 3:10828008-10828030 GTTACTAAGGGAAACGAGGATGG - Intronic
950446430 3:13041528-13041550 GTTATTAAAGACCTGGAGGAGGG - Intronic
951036390 3:17937371-17937393 GTTATAAAAGGGACTTAGGACGG - Intronic
951059739 3:18191221-18191243 GGTATTAAAGGTACAGAGGAAGG - Intronic
952444502 3:33367376-33367398 CATATTAAAGAAATTGAGGCCGG - Intronic
953188168 3:40657651-40657673 GTTACTAAAGGAATTCTGGAAGG - Intergenic
957239468 3:77639549-77639571 GTTATTCCAGGAAATGAGAATGG + Intronic
957729756 3:84118635-84118657 GTTAGTAAAGTCCTTGAGGAAGG + Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
960408425 3:117291272-117291294 GTTACTAAAAGAATTGTGGTAGG - Intergenic
960598352 3:119429356-119429378 GTAAATAAAGGAGTAGAGGAGGG - Intergenic
960661836 3:120068782-120068804 GTAATTATAGAAATTGATGATGG + Intronic
960728821 3:120701596-120701618 GTGATGAAAGGAATTGAGATAGG + Intronic
961725210 3:128923699-128923721 GTTTTTAAATTAATTGAGCAAGG - Intronic
962825234 3:139095101-139095123 GTTAGCAAAGGAAGTGAGTATGG + Intronic
963058542 3:141206672-141206694 GTGATTAAAGGATTATAGGATGG - Intergenic
963612955 3:147495120-147495142 GTTATAGAAGGAAATAAGGAGGG + Intronic
963875685 3:150471976-150471998 GTTATTAAATGAATGAATGAGGG + Intergenic
965873445 3:173287846-173287868 GTTAAAAAACAAATTGAGGAGGG - Intergenic
966408891 3:179628373-179628395 CTAATTAAAGAAATTGAAGAGGG - Intergenic
966850062 3:184159088-184159110 GTTATTTGAGAAATGGAGGAAGG + Intronic
969176562 4:5403262-5403284 GGAATTAGAGGAAGTGAGGAGGG - Intronic
970388662 4:15583989-15584011 CTGATGAAAGAAATTGAGGAAGG + Intronic
970919639 4:21378334-21378356 TTTATTAAAGGAATTTATTATGG - Intronic
971118787 4:23680486-23680508 GTTATTAATGGTATTGATGTTGG - Intergenic
971530594 4:27683775-27683797 GTTATTAGTGGACTTGGGGAAGG + Intergenic
971592575 4:28487072-28487094 GTTGTTAAATAAATTGACGAAGG - Intergenic
971728386 4:30343816-30343838 CTTATTAAAAGAATTGAAAAGGG + Intergenic
972290910 4:37688980-37689002 CTTGTTAAAGGAATGAAGGAAGG + Intergenic
972383563 4:38541844-38541866 GTTCTTAATGGCATTGAGAATGG + Intergenic
973693205 4:53462219-53462241 GTTATAAAAGGAATGGGAGAAGG + Intronic
973782733 4:54304273-54304295 GTCATAAAATGAATTAAGGAGGG - Intergenic
974164770 4:58187059-58187081 TTTATTAATGGATTTTAGGAAGG - Intergenic
974325455 4:60408627-60408649 TTTATGAAAGCATTTGAGGAAGG - Intergenic
976036797 4:80833485-80833507 ACTTTTAAAGGAAATGAGGAGGG + Intronic
976359640 4:84162298-84162320 GTGAGTGAAGCAATTGAGGAAGG + Intergenic
976742706 4:88373502-88373524 CTGATTAAAGAAATTGAAGAGGG + Intergenic
976812937 4:89116248-89116270 GTTATAACAGGAAATGAGAATGG + Intergenic
977315102 4:95436735-95436757 GCTAATAAAACAATTGAGGAAGG + Intronic
977820193 4:101462378-101462400 GTTATTAAAGGGAAGGATGATGG + Intronic
978306503 4:107334249-107334271 GTTTTTAAATTAATTGAGCAAGG - Intergenic
978739664 4:112122373-112122395 GTTATTAAGGAAGTTGAGGTGGG - Intergenic
978768225 4:112426940-112426962 TTTATTCAAGAAATTGAGGAAGG + Intronic
979549004 4:121969242-121969264 ATTATTAAAGGAAGGGAGGGAGG - Intergenic
979659029 4:123231245-123231267 GTTGCTAAGGTAATTGAGGAAGG - Intronic
979872559 4:125843326-125843348 GTAATTATTGGAATTGATGATGG + Intergenic
980175289 4:129337186-129337208 TTTATGAAAGGGATTGAGAAGGG - Intergenic
980232376 4:130061334-130061356 TTTATAAAATGGATTGAGGATGG - Intergenic
981884585 4:149658639-149658661 CTTATTAAAGAAATTGAGGAAGG - Intergenic
983739068 4:171105216-171105238 GTTCTAAATGGAATTTAGGATGG - Intergenic
983800704 4:171926130-171926152 TTTAATTGAGGAATTGAGGAGGG - Intronic
984111518 4:175622532-175622554 GCTATTATAGAAATTCAGGAAGG + Intergenic
986309185 5:6539109-6539131 GTTGTTAAATGAATGGAGGGAGG + Intergenic
986535991 5:8787760-8787782 ATTATTAAAGGACATGATGAAGG + Intergenic
988323120 5:29726157-29726179 GTCATTAAGTGAATTAAGGAGGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989652422 5:43708248-43708270 GTGATTAAAGGCATTTAGCATGG + Intergenic
990054813 5:51559823-51559845 CTTATTAAATGAATGGAAGATGG + Intergenic
990257972 5:53991239-53991261 GATATAAAAGGAATTGAAGCAGG + Intronic
990590062 5:57253179-57253201 GTTATTTAAGGAATACAGTAAGG - Intronic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993111054 5:83657688-83657710 TTTTTAAAATGAATTGAGGATGG + Intronic
993254129 5:85565764-85565786 TTTATTTAATGAGTTGAGGATGG - Intergenic
994167507 5:96623162-96623184 GTTATTAAAATTATTGAGGTAGG - Intronic
997859674 5:137405278-137405300 GTAATTATATGAATTGATGAGGG - Intronic
997969811 5:138391911-138391933 GTTACTAAAGGTTTTGAGGAGGG - Exonic
998746529 5:145266232-145266254 GTTCTTACAAGAAATGAGGAGGG + Intergenic
999009229 5:148016768-148016790 ATTTTTAATGGAATTTAGGAAGG - Intergenic
999389493 5:151179925-151179947 GTTATAAGAGGAAGTGAGGTAGG - Intergenic
999848910 5:155516121-155516143 GTTATTTAAAGAAGGGAGGAGGG + Intergenic
1000585218 5:163088866-163088888 TTTATTAAATGAATTGATAAAGG + Intergenic
1000805576 5:165786548-165786570 GTTTTTGAAGGAAAAGAGGAAGG + Intergenic
1000926183 5:167197414-167197436 TTTGTTAAAGGAATGGAGGAGGG + Intergenic
1004162355 6:13225856-13225878 GGTATTATAGGAAGTAAGGATGG - Intronic
1004758959 6:18644696-18644718 GTCATAAAAGGAACTGAGGAGGG + Intergenic
1005013093 6:21354612-21354634 TTTATTAAAGGAATTGGAGAAGG + Intergenic
1005468395 6:26137908-26137930 GTTATTTGAGGAATTGAGAAGGG + Intronic
1006566294 6:34960585-34960607 GTTTTTAAAGGAATGGAGAGAGG + Intronic
1008245773 6:49171160-49171182 GTTATTTCAGGAAATGAGAAAGG - Intergenic
1008259366 6:49346011-49346033 TTTATTGAAGGAATTTAGGTGGG - Intergenic
1009590102 6:65657366-65657388 GTTCTTAATGGAATTTAGAATGG - Intronic
1009692398 6:67053011-67053033 TTGATTAAAGAAATTGAAGAAGG + Intergenic
1010017786 6:71124586-71124608 GTGATTAAAAGAATTGAAGTGGG - Intergenic
1010747844 6:79584459-79584481 GTTCTGAAAGGCATTCAGGAAGG - Intergenic
1011972659 6:93246963-93246985 GTTATAAAAGCAATAGAAGAAGG - Exonic
1013687183 6:112599249-112599271 ATTATTAAAAGAGTTGATGATGG + Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1016703820 6:147083542-147083564 GTTTTTAAAATAATTGAGCATGG - Intergenic
1017854196 6:158334820-158334842 CTTATAAAAGGGCTTGAGGAAGG + Intronic
1018406061 6:163483802-163483824 GTTCTTAATGGCATTGAGAATGG + Intronic
1019729316 7:2621855-2621877 GTGAGTAAATGAATTTAGGATGG - Intergenic
1019984169 7:4642857-4642879 GTTCTAAAAGGATTTGAGAAAGG + Intergenic
1020719351 7:11721942-11721964 CGTATTAAAGGAATTGGGAAGGG - Intronic
1020911712 7:14139709-14139731 TTTATTACAGGAAATGATGAAGG + Intergenic
1021131848 7:16921304-16921326 TTTATAAAAGGAATACAGGAAGG - Intergenic
1021215293 7:17908817-17908839 GTTATTACAAGACTTTAGGAAGG + Intronic
1021570896 7:22064146-22064168 GCTATTGAAGGAATTAGGGAGGG + Intergenic
1021786219 7:24155386-24155408 TTTATTCAAGAAATTGAGGTAGG + Intergenic
1023775486 7:43602031-43602053 GATATTAGAGGAAGAGAGGAGGG - Intronic
1026460757 7:70613424-70613446 ATTATGAAAGGAGATGAGGAGGG + Intronic
1026583311 7:71635674-71635696 TTTATTAAAGGAATAAAGAATGG + Intronic
1026599001 7:71758292-71758314 TTTATGAAAGAAATTGAAGAAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026929868 7:74217859-74217881 GTTGCAAAAGGAAATGAGGAAGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027760278 7:82269174-82269196 ACTATTAAAGAAATTCAGGATGG - Intronic
1028687252 7:93604516-93604538 GTTTATAAAAGATTTGAGGATGG - Intronic
1029572572 7:101379965-101379987 GTAAGTAAAGGAATAGAGAATGG - Intronic
1030257180 7:107523369-107523391 GTTAATAAAAGAGTTGAGTAAGG - Intronic
1030276175 7:107724078-107724100 GGGATGAAAGGAATTTAGGATGG + Intergenic
1030319045 7:108145411-108145433 GTTAATAAAGAAATGGAGAAGGG + Intergenic
1030425340 7:109369604-109369626 GTTATTAAAGAAGTAAAGGAAGG + Intergenic
1030671916 7:112347379-112347401 ATTATTGAAGAAATGGAGGATGG - Intergenic
1030781024 7:113600424-113600446 AATATTAAAAGATTTGAGGAGGG + Intergenic
1031175967 7:118350548-118350570 GTTCATAAAGAAATTGAAGATGG - Intergenic
1031319055 7:120298852-120298874 GTAAGTAAAGAAATTGAGAATGG + Intronic
1032336611 7:131030599-131030621 GTTCTTAGAGGGATAGAGGAGGG + Intergenic
1033659508 7:143393842-143393864 GTTATGAAGAGCATTGAGGATGG - Exonic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033986481 7:147232157-147232179 TTTATGAAAGAAATTGAAGAAGG + Intronic
1034143405 7:148845264-148845286 GTTCTTAAAGGGAATAAGGATGG - Intronic
1034671684 7:152863506-152863528 GTTAATAAAGGATGTGAGAAGGG + Intergenic
1035815615 8:2536913-2536935 TTGATGAAAGAAATTGAGGAGGG - Intergenic
1036506049 8:9357226-9357248 GTGATTAAAGGAAATGCTGAGGG - Intergenic
1036668268 8:10762608-10762630 ATTATTAAAATAATTCAGGAGGG + Intronic
1037656208 8:20886312-20886334 TTTACTAAAGGACTTGAGTAGGG - Intergenic
1038757446 8:30354664-30354686 ATTATGAAAGGAATTGATGGTGG - Intergenic
1039455521 8:37703390-37703412 GTTATTACAGCCATTGGGGAGGG - Intergenic
1042185857 8:66135594-66135616 GGGATAAAAGGCATTGAGGAGGG - Intronic
1042585100 8:70328467-70328489 TTTATTCAAGGAATTTAAGATGG - Intronic
1043090281 8:75892824-75892846 GTTATAAAAAGGTTTGAGGAAGG + Intergenic
1043252584 8:78093821-78093843 ATTATGAATGGAATTGAGAAAGG + Intergenic
1043270530 8:78327782-78327804 TTTATTATAGGAATTGATGAAGG - Intergenic
1043431848 8:80202458-80202480 TTTATAAAATGAATTTAGGAAGG - Intronic
1043849477 8:85199510-85199532 GGTGTTAAATGAATGGAGGAAGG + Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045540863 8:103083534-103083556 TTTATTGAAGCATTTGAGGAAGG - Intergenic
1046372131 8:113324091-113324113 GTTGTTAAAGGCATTCAGAAGGG + Intronic
1046719837 8:117606915-117606937 GTCATTTAAGGAATCCAGGAGGG - Intergenic
1046835003 8:118790487-118790509 CTTATAAAAGGATGTGAGGATGG + Intergenic
1047488965 8:125358561-125358583 GTTATTACAGGAACAGAGCATGG - Intronic
1047724374 8:127671301-127671323 TTTATTACAGGAATGGAGCAAGG - Intergenic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049874258 8:145005285-145005307 GTCATTAAAGGATTTAAGCAGGG + Intergenic
1051419814 9:16877822-16877844 GTTATTACAGGCTTTGAAGATGG - Intergenic
1051985611 9:23083258-23083280 GTTTTGAAAGGAATTTGGGATGG + Intergenic
1055031265 9:71773118-71773140 GTTATTATAAGAATTAAGTATGG + Intronic
1055898506 9:81208164-81208186 TTCATTAAAGAAATTGAGGCCGG + Intergenic
1056151095 9:83789565-83789587 TTATTTAAAGGAATCGAGGAAGG - Intronic
1057600422 9:96451883-96451905 TATAATAAAGGAATTGAGGAAGG + Intronic
1058703898 9:107623194-107623216 GGTATTAAAGGAGCTGAGAACGG + Intergenic
1059040146 9:110805268-110805290 GTTAATAAAATAATTCAGGAAGG - Intergenic
1060790278 9:126481322-126481344 GGCATTAAAGGTATTGAAGATGG - Intronic
1187065523 X:15833558-15833580 GTTATTAAAGCAATTTAAAATGG - Intronic
1187287260 X:17917466-17917488 GTTATAACAGGGATGGAGGAGGG + Intergenic
1187424767 X:19167097-19167119 GTAATTAAAGGGTATGAGGATGG + Intergenic
1188456120 X:30368402-30368424 GTTCTCAAAGGAAATTAGGAGGG - Intergenic
1188655183 X:32684971-32684993 GTCAATAAAGGAATTTAGTATGG - Intronic
1188852471 X:35149463-35149485 GTCATTAAAGGGATTGCTGAAGG - Intergenic
1189050981 X:37645287-37645309 GTCATTAAAGGGATTCAGCATGG - Intronic
1189593295 X:42538268-42538290 GGAAGGAAAGGAATTGAGGAGGG - Intergenic
1190239675 X:48647823-48647845 GTTAGTAAAGGAATTGATAGAGG + Intergenic
1192043234 X:67644950-67644972 GTCAGAAAAGGAAATGAGGATGG + Intronic
1192972485 X:76248702-76248724 ATTATTAAAGGAAATGATAATGG - Intergenic
1193282609 X:79671580-79671602 CTGATAAAAGAAATTGAGGAGGG - Intergenic
1193471920 X:81916129-81916151 GTCAGTGAAGGAAGTGAGGAAGG + Intergenic
1194733395 X:97482628-97482650 GATATAAAAGGAAAAGAGGAGGG + Intronic
1196414127 X:115453224-115453246 GTTATGAAAGGAATTGATATTGG + Intergenic
1197758493 X:130012450-130012472 GTTACTACAGGAAGTGAGGTAGG + Intronic
1198890686 X:141392348-141392370 GTTATTCAAGGAAATCAGCATGG + Intergenic
1199565565 X:149212161-149212183 ATCATCAAAGGAATTGGGGATGG + Intergenic
1200412531 Y:2875767-2875789 GGTGTCAAAGGAAATGAGGAAGG - Intronic