ID: 1131380422

View in Genome Browser
Species Human (GRCh38)
Location 15:91959133-91959155
Sequence GCTGGAGGCTGTTATTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 2, 2: 16, 3: 56, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131380416_1131380422 23 Left 1131380416 15:91959087-91959109 CCATAAAAAGGAACGAAATAATG 0: 43
1: 849
2: 2034
3: 5728
4: 9941
Right 1131380422 15:91959133-91959155 GCTGGAGGCTGTTATTCTAAGGG 0: 1
1: 2
2: 16
3: 56
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131380422 Original CRISPR GCTGGAGGCTGTTATTCTAA GGG Intronic
902065041 1:13678549-13678571 CCTGGAAGCTGTTATTGTACTGG - Intergenic
902911936 1:19605082-19605104 GCTGTAGCCTGTGATCCTAAAGG - Intronic
904730265 1:32585334-32585356 GCTAAAGTCTCTTATTCTAATGG - Intronic
904932501 1:34100864-34100886 GCTGGAGGCAGTTACTGTATAGG - Intronic
905851760 1:41279991-41280013 GCTGGGGGCTGTGAACCTAAGGG + Intergenic
906489981 1:46260705-46260727 ACTGAAGGCTGTTATTCTCTAGG + Exonic
906916576 1:50017596-50017618 GCTGGAGGCCATTATACTAAGGG + Intronic
909334755 1:74459202-74459224 GCTGGAGGCCATTATCCTAAGGG + Intronic
910610881 1:89140911-89140933 GCTGGAGGTCAATATTCTAAGGG + Intronic
911248119 1:95542408-95542430 GCTGGAGGCCATTACCCTAAGGG - Intergenic
912657134 1:111497020-111497042 ACTGCGGGCTTTTATTCTAAAGG - Intronic
913059083 1:115188252-115188274 GCGGGACGTTGTTATTCTTAGGG + Intergenic
914953724 1:152143454-152143476 GCTTGAGGGTATTATGCTAAGGG - Intergenic
915047222 1:153028293-153028315 GCTGAAGGCCATTATCCTAAGGG - Intergenic
915070945 1:153266354-153266376 GCTGGAGGATATTATGTTAAGGG - Intergenic
917612232 1:176700269-176700291 GCAGGAGGCTGGTACTCCAAAGG + Intronic
918730409 1:187986162-187986184 ATTGGAGTCTGTTATGCTAAAGG + Intergenic
918731425 1:188001955-188001977 GCTGGAGGCCATTATTTTAGGGG - Intergenic
918877149 1:190062485-190062507 GCCTGAGGTTGTTATACTAAAGG + Intergenic
919028770 1:192211721-192211743 GCTGGAGGCCATTATTCTAAGGG + Intergenic
919666187 1:200295089-200295111 GCTGGAGGCCATTATCCTAAGGG + Intergenic
920864472 1:209740456-209740478 ATTGGAGACTATTATTCTAAGGG + Intergenic
921213454 1:212918735-212918757 GCTTGAGGGCTTTATTCTAAGGG - Intergenic
921963432 1:221061798-221061820 CTTGGAGACTATTATTCTAAGGG + Intergenic
922675330 1:227545986-227546008 GCTGGAAACTGTTTCTCTAAAGG - Intergenic
923731864 1:236559021-236559043 GCTGCAGCTTGTTATTCAAAAGG + Exonic
1063156497 10:3384045-3384067 ATTGGAGGCCATTATTCTAAGGG - Intergenic
1064198945 10:13268512-13268534 GCTGGAGGCCATTATCCTAAAGG + Intergenic
1064687241 10:17875542-17875564 ACTGGAGACCATTATTCTAAGGG - Intronic
1065131508 10:22625506-22625528 TCTGGAGTCTATTGTTCTAAGGG + Intronic
1065173927 10:23059039-23059061 GATGGAGGCTGTTTTTATAAAGG + Intergenic
1065803948 10:29377895-29377917 GCTGGAGGCCATTATTCTTCAGG - Intergenic
1065899836 10:30196225-30196247 GCTGGAGGCCATTATCCTAAGGG - Intergenic
1066164963 10:32777158-32777180 GCTGGAGGCCATTATCCTGAGGG - Intronic
1068370324 10:56104321-56104343 TCTGGAGGCCATTATCCTAAGGG - Intergenic
1068787127 10:60988583-60988605 GCTGGAGGCCATCATCCTAAGGG - Intronic
1069356704 10:67595008-67595030 GCTGGAGACTATTATTCTAAGGG - Intronic
1070807192 10:79277530-79277552 GGTGGAGGCTGTTTTTCTTCAGG + Intronic
1073518487 10:104101626-104101648 GATGGAGACTGTTCTGCTAAGGG + Intergenic
1075626598 10:123968427-123968449 GCTGGAGGCTGGGATTTTATGGG - Intergenic
1077258283 11:1599587-1599609 GCTGGAGGCCGTTATCCTAAGGG + Intergenic
1079637116 11:22757043-22757065 TCTGGAGCCTAATATTCTAAAGG - Intronic
1080071477 11:28093694-28093716 GCAGGAGGCTGATATAATAAGGG + Intronic
1080442762 11:32310667-32310689 CTTGGAGGCTGTTGATCTAAGGG + Intergenic
1080951699 11:37041185-37041207 GCTGGTAGCTGGTATTATAATGG + Intergenic
1081022675 11:37967496-37967518 GCTGGAGGCCATTATTCTAAGGG + Intergenic
1081268786 11:41058918-41058940 GCTGAAGGCCATTATTCTAAGGG + Intronic
1081822606 11:46014291-46014313 GCTGGAGGCCATTATCCTAAGGG - Intronic
1083855536 11:65391210-65391232 CCTGGAGGCTGCTATCCAAATGG - Intronic
1086797155 11:91120350-91120372 TCTGGAGGCTGCCATTCTACTGG + Intergenic
1087220396 11:95540826-95540848 GCTGGAGGCCATAATTCTAAGGG + Intergenic
1087278061 11:96180187-96180209 GATGGATGGTGTTTTTCTAAAGG + Intronic
1091981420 12:4867183-4867205 GCTAGAGGCCATTATCCTAAGGG - Intergenic
1093787851 12:23213438-23213460 GCTGGAGGCCACTATCCTAAGGG - Intergenic
1093811775 12:23500566-23500588 GCCAGAGGCCATTATTCTAAGGG - Intergenic
1094207246 12:27853504-27853526 GCTGGAGGCCGTTATCCTAAGGG - Intergenic
1095117782 12:38376389-38376411 ACCAGAGGCTATTATTCTAAGGG - Intergenic
1095444357 12:42269404-42269426 GCTAGAGGCCATTATCCTAAGGG + Intronic
1095557900 12:43529516-43529538 GCTGGGGGCCATCATTCTAAGGG + Intronic
1096983368 12:55742017-55742039 GCTGGAGGCTGTTATACTTGGGG - Intergenic
1098717922 12:73855588-73855610 GCTGGAGGCCATTATCCTAAAGG - Intergenic
1098934662 12:76464943-76464965 TCTGAAGTTTGTTATTCTAAGGG - Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1102466111 12:113131669-113131691 GCTGGTGACTGTTATTATGAAGG - Intronic
1102540489 12:113615755-113615777 ATTGGAGACTATTATTCTAAGGG + Intergenic
1106056727 13:26244894-26244916 ACTGGAGGCTATTATGTTAAGGG + Intergenic
1106395428 13:29375705-29375727 GCTGGAGGCCATTATTCTAAGGG + Intronic
1106531281 13:30594506-30594528 ACTGGAGGCAATTATCCTAACGG - Intronic
1107563101 13:41575125-41575147 GCTGGAGGCCATTATTCTAAGGG + Intronic
1109495044 13:63158502-63158524 GCTGGAGGCCATTATTCTAAGGG - Intergenic
1109637710 13:65144524-65144546 GCTAGAGGCTATTATACCAAGGG - Intergenic
1110009845 13:70318232-70318254 ACTGGAGTCTGTTATACTAAAGG - Intergenic
1110205038 13:72902099-72902121 ATTGGAGACTATTATTCTAAGGG + Intronic
1111543335 13:89697334-89697356 ACTGGAGGCCGTTATCCTAAGGG - Intergenic
1111758003 13:92422720-92422742 GCTGGAGGCACTAATTCTAGAGG + Intronic
1112227124 13:97550884-97550906 GCTGTTGGGTGTTATTTTAATGG - Intergenic
1113540788 13:111107378-111107400 GCTGGAAGCCATTATCCTAAGGG + Intergenic
1113867876 13:113539997-113540019 GCTGGAGGCCGTTCTCCTCAGGG - Intronic
1114351466 14:21856452-21856474 GCTGGAGGCCATTATCCTAAGGG - Intergenic
1114592118 14:23875792-23875814 GCTGGAGGCCATTATCCTAAGGG - Intergenic
1115182385 14:30644124-30644146 GCTGGAGGTCATTATTCTAAGGG - Intronic
1115526705 14:34287682-34287704 ATTGGAGACTATTATTCTAAGGG - Intronic
1116800173 14:49435405-49435427 ACTGGAGGCCATTATCCTAAGGG + Intergenic
1117983696 14:61366817-61366839 TCTGGGGGCTCTTATTATAATGG + Intronic
1119565656 14:75626994-75627016 GCTGGAGGTTGTTGGTCTTAGGG + Intronic
1120288250 14:82533285-82533307 GGTGGAGGCTTTTATTCAATAGG - Intergenic
1120425942 14:84348459-84348481 CCTGGAGTCTGTTGTTCTCAAGG - Intergenic
1122822350 14:104353911-104353933 GCTGCAGGCTGTGAATCTGAAGG + Intergenic
1123814549 15:23963282-23963304 ACTGGAGGCCATTATCCTAAGGG - Intergenic
1125228633 15:37426500-37426522 GCTGGAGGCCATTATTCTGAGGG + Intergenic
1126241119 15:46444802-46444824 GCTGGAGGCTATTGTCCTAAGGG - Intergenic
1127246745 15:57184951-57184973 TCTGGAGGTTATTATTTTAATGG + Intronic
1128255578 15:66194209-66194231 ACTGGAGACCTTTATTCTAAGGG + Intronic
1129597436 15:76975661-76975683 GGTGCGGGCTGTTATTATAAGGG + Intergenic
1130362293 15:83200801-83200823 TCTGGAGGATGTCATTCTGAAGG + Intronic
1131175620 15:90207641-90207663 GCAGGAGGCAGCTGTTCTAATGG - Intronic
1131380422 15:91959133-91959155 GCTGGAGGCTGTTATTCTAAGGG + Intronic
1131699076 15:94913255-94913277 CATGGAAGCTGTTATACTAATGG - Intergenic
1132195296 15:99909977-99909999 GCTGGAGTCTGCTTCTCTAAGGG + Intergenic
1132697595 16:1208882-1208904 GGTGGAGGCTGTGATTTTAGGGG - Intronic
1133422515 16:5658632-5658654 ATTGGAGACTATTATTCTAAGGG - Intergenic
1133822356 16:9247867-9247889 GCAGGAGACTGTTATAATAAAGG + Intergenic
1135621900 16:23963022-23963044 GTTGGAGGCCATTGTTCTAAGGG - Intronic
1135869186 16:26133582-26133604 GCTGGATGTTGTTAGTATAATGG - Intronic
1139173109 16:64654715-64654737 ACTGGAGGCCATTATCCTAAGGG + Intergenic
1141216873 16:82033285-82033307 CCTGGAAGCTGTTTTTCGAACGG + Intergenic
1141720839 16:85754405-85754427 GCTGGAGGCTGGGATTCTTCAGG + Intergenic
1142323705 16:89400821-89400843 GCTGGAGGCTGGTCATCTGACGG + Intronic
1144232019 17:13216997-13217019 GGTGGATTCTGTAATTCTAAAGG + Intergenic
1151033461 17:70770604-70770626 GTTGAAGGCTTTAATTCTAAGGG + Intergenic
1153085691 18:1284134-1284156 GCTGGAGACCCTTATCCTAAGGG + Intergenic
1156327529 18:36087630-36087652 GTTGGAGACCATTATTCTAAGGG + Intergenic
1157876539 18:51279144-51279166 ACTGAAGGCTGTTATACTCATGG + Intergenic
1158843290 18:61411723-61411745 ATTGGAGACTATTATTCTAAGGG + Intronic
1159063589 18:63542919-63542941 GCTGGAGGCTATTATCCTAAGGG - Intergenic
1159619833 18:70624175-70624197 TCTGCAGGCCGTGATTCTAAAGG - Intergenic
1161873382 19:6887932-6887954 TCTTGAGGCTGATATTCTAGTGG + Intronic
1163050351 19:14678622-14678644 GGTGGAGGTTGTTGTTATAATGG + Intronic
1164489536 19:28693859-28693881 ACTGGAGGCCATTATTCTACAGG - Intergenic
1164610891 19:29630982-29631004 GAAGGAGGCTGTTCCTCTAAAGG + Intergenic
1164728293 19:30481945-30481967 GTTGGAGGCCATTATTCTATGGG - Intronic
1167632767 19:50635951-50635973 GCTGGAAACTGTTATACTCATGG - Intronic
1168507469 19:56948617-56948639 GCTAAAGGCCCTTATTCTAAGGG + Intergenic
927670748 2:25066673-25066695 GCTGCATGCTGTTACTCTAAGGG + Intronic
928451839 2:31384796-31384818 CCTGGAAGCTGATATTCAAAAGG - Intronic
929300752 2:40301456-40301478 ACTGGAGACTATTATTCTAAGGG + Intronic
929300874 2:40302353-40302375 ACTGGAGACTATTATTCTAAGGG - Intronic
929373502 2:41255868-41255890 GCTGGAGGCCATAATCCTAAGGG + Intergenic
929701814 2:44168976-44168998 GCTGGAGTCTCTGATTCTCAGGG + Exonic
930135617 2:47901520-47901542 GCTGGAGGCTGATGTACGAAGGG + Intronic
930275920 2:49310970-49310992 GCTGTAGGCAATTATCCTAAGGG - Intergenic
933223599 2:79719193-79719215 GCTGGAGGCCATAATCCTAAGGG - Intronic
933241098 2:79921141-79921163 GCAGGAGACTGTTATTCTGTAGG - Intronic
933358974 2:81253088-81253110 GCTGGAGACCATTATCCTAAAGG - Intergenic
933477091 2:82804643-82804665 GAGGTAGGCTGTTAGTCTAATGG - Intergenic
935001173 2:99017368-99017390 GTTGGAGACCATTATTCTAAGGG + Intronic
935007581 2:99095111-99095133 ACTGGAGACCATTATTCTAAGGG + Intronic
935232623 2:101112219-101112241 GCTGGCTGCTGTGATGCTAAGGG - Intronic
936477077 2:112848678-112848700 GCTGGAGGCTGTCATCCAAGAGG - Intergenic
937760625 2:125598249-125598271 CCTGGAGGCTATTATCTTAAGGG - Intergenic
941325699 2:164111344-164111366 GCTGGAGACTGCTGTTTTAAGGG - Intergenic
941700398 2:168598154-168598176 GATGGAAGCAGCTATTCTAAGGG - Intronic
942925935 2:181432279-181432301 GCTGGAGGGCATTATTCTAAGGG - Intergenic
943053489 2:182946022-182946044 GCTGGAGACCATTATCCTAAGGG + Intronic
943180443 2:184534250-184534272 GCTGGAGGCCACAATTCTAAGGG + Intergenic
943263038 2:185690078-185690100 GCAGAAGGCTGTTATAGTAACGG + Intergenic
943391115 2:187269033-187269055 GCTGGAGGCCATTATCTTAAGGG - Intergenic
943613156 2:190058718-190058740 GCTGGAGGCCATTATTCGAAGGG + Intronic
944585638 2:201171014-201171036 CCTGGAGACTATTACTCTAAAGG + Exonic
944586552 2:201178536-201178558 GCTGAAGGCTGTTGTTTTACCGG - Intergenic
945911060 2:215649760-215649782 GCTGGAGGCCATTATTCTAAGGG - Intergenic
946746750 2:222853952-222853974 GCTTGAGGATGATATTCTATTGG + Intergenic
946836848 2:223781065-223781087 GCTGGAGGCCGTTATCCTAAGGG - Intronic
947891474 2:233625653-233625675 GCTGGAGGTCATTATCCTAAGGG + Intronic
948559868 2:238845711-238845733 ACTGGAGGCTGTGATACTGACGG - Intergenic
948674502 2:239589041-239589063 GCTGGAGGCTGTTCTACAAAAGG - Intergenic
1169918202 20:10705062-10705084 GCTTGAGGACGTTATGCTAAGGG - Intergenic
1170471214 20:16670026-16670048 GCTGCAGCCTGATATTCCAAGGG + Intergenic
1171222600 20:23413292-23413314 GCAAGAGGCTTTTATTGTAAGGG - Intronic
1173095898 20:40027915-40027937 GCTGGAGGCCATTATTCTAAGGG - Intergenic
1174803455 20:53585223-53585245 GCTGGTGTCTCTTTTTCTAAAGG - Intronic
1175752000 20:61505057-61505079 GCTGGAGGCTGTTTTCCTGGTGG + Intronic
1176042742 20:63073788-63073810 CCTGGGGGCTGTTGGTCTAAGGG + Intergenic
1176054836 20:63139424-63139446 GCTGGAGGCTGTGACTAAAAAGG + Intergenic
1176938383 21:14893904-14893926 GCTGGAGTCTGTGTTTCTAATGG + Intergenic
1177718473 21:24872247-24872269 GCTGGAGGCCATAATCCTAAAGG - Intergenic
1178870090 21:36366314-36366336 GCTGGAGGCCTTTATCCTAAGGG - Intronic
1179121836 21:38554535-38554557 GCTGGAGGCCATTATCCTAAGGG + Intronic
1179171796 21:38978691-38978713 GCTGGAGGCCATTATCCTAAGGG - Intergenic
1182324157 22:29499222-29499244 ACTGGAGACTATTATTCTAAGGG - Intergenic
1183106388 22:35618041-35618063 GCTGGCTGCTATTATCCTAATGG - Intronic
950630181 3:14276929-14276951 GCTGGAGGCTGTACCCCTAATGG - Intergenic
951948945 3:28176690-28176712 GCTGGAGGTTGTTTTTGTAAAGG - Intergenic
952411493 3:33053778-33053800 GCTGGAGTCTGTTTTTATAGGGG - Intronic
952856700 3:37777315-37777337 GCTGGAGCCTCTTATTGTAGAGG - Intronic
954966517 3:54616233-54616255 GCTGGGGGCTGGTCTTCCAAGGG + Intronic
956012720 3:64848832-64848854 AATGGAGGCTGTTTTTCTACTGG + Intergenic
956485584 3:69718913-69718935 GCTGGAAGCTGGAATCCTAATGG + Intergenic
958695883 3:97526834-97526856 GATGGAGGCTGACAGTCTAATGG + Intronic
958722235 3:97858239-97858261 GATATATGCTGTTATTCTAATGG + Intronic
959266793 3:104151129-104151151 GCAGGAGGCTATTATCCTGAGGG - Intergenic
962227256 3:133624302-133624324 GCTTGAGCCTGTCATTTTAATGG - Intronic
963322890 3:143828685-143828707 GAAGGAGGCTGATATTCAAAGGG + Intronic
963410370 3:144920102-144920124 GCAGTAGGCTGTTATTGAAAAGG - Intergenic
963687085 3:148449878-148449900 ACTGGAAGCCATTATTCTAAAGG + Intergenic
964134229 3:153326358-153326380 GCTGGAGGTCATTATCCTAAGGG - Intergenic
965389746 3:168090882-168090904 CCTGGAGGCCATTATCCTAAGGG + Intronic
968985939 4:3874294-3874316 GCTGGAGGCTGGTGTCATAAAGG - Intergenic
969641055 4:8399037-8399059 GCTGGGGACTGTTATTCCAAGGG + Intronic
970995874 4:22267169-22267191 TCTGGAGGCTGAAATTCCAAGGG - Intergenic
973714359 4:53660531-53660553 GCTGGAGGCCATTATCCTAAGGG + Intronic
974826346 4:67135563-67135585 GCTGGAGGCCATTATCCTAAGGG - Intergenic
975669574 4:76767377-76767399 GCCAGAGGCTGGTATTTTAAAGG - Intronic
976277540 4:83292722-83292744 ACTGGGGGCTGTTATCCTAAGGG + Exonic
976361641 4:84185566-84185588 GCTGGAGGCCGTTATTCTAAGGG - Intergenic
977508015 4:97926482-97926504 GGTGGAGCATGTTCTTCTAATGG - Intronic
978240665 4:106512365-106512387 GCTGGAGGTCATTATCCTAAGGG - Intergenic
978934315 4:114356497-114356519 GCAGGATGCTGTTATTTTATTGG + Intergenic
979372636 4:119907750-119907772 GCTAGAGGCCATTATCCTAAGGG - Intergenic
979426792 4:120577302-120577324 GCTGGAGGCCACTATCCTAAGGG + Intergenic
979584403 4:122398268-122398290 GTTGGAGACCATTATTCTAAGGG - Intronic
980208554 4:129754852-129754874 GCTGGAAGCCATTATCCTAAGGG + Intergenic
980886558 4:138768740-138768762 CCTTGAGGATGTTATGCTAAGGG - Intergenic
982376822 4:154700643-154700665 CCTGGAGGATGTTATACTAAGGG + Intronic
983303979 4:165962773-165962795 GCTGGAGGCAATTATCCTAAGGG + Intronic
983462408 4:168044117-168044139 TCTGGAGGTTATTATTATAAGGG + Intergenic
984104658 4:175529967-175529989 GCTGGAATCTTTTATTCTAGGGG + Intergenic
984410140 4:179387380-179387402 ACTGGAGGCCATTATTCTAACGG + Intergenic
985381340 4:189398283-189398305 TCTGGAGGCTGTAAGTCCAAAGG + Intergenic
986408597 5:7452381-7452403 ACTGGAGGCCATTATTCCAAGGG - Intronic
986522912 5:8641111-8641133 GCTGGAGGCCAAAATTCTAAAGG + Intergenic
987605026 5:20123335-20123357 GCTGGAGGCTGTGTTTCCCATGG + Intronic
987995784 5:25276570-25276592 GATGGAAGCTGTTATTTTGAGGG - Intergenic
988072806 5:26315992-26316014 ACTGAAGGCCTTTATTCTAAGGG - Intergenic
988204910 5:28121825-28121847 GCTGGAGGCCATAATTCTAAGGG + Intergenic
988321386 5:29701602-29701624 GTTGGAGGCTATTATCCTAATGG - Intergenic
988757390 5:34271576-34271598 GATAAAGGCTGTTAGTCTAATGG - Intergenic
989529611 5:42492458-42492480 ACTGAAGGCTGTTTTTCTATAGG + Intronic
992248986 5:74858447-74858469 GATGGAGGCTATTATCCTAAAGG + Intronic
994884304 5:105539724-105539746 ATTGGAGGGTGTGATTCTAATGG + Intergenic
995061988 5:107821119-107821141 TCTATAGGCTGTTATTGTAATGG + Intergenic
995554055 5:113309489-113309511 ACTGGAGTCTATTATCCTAAGGG - Intronic
995645261 5:114304549-114304571 GCTGGAAGCTGTTTATCAAATGG + Intergenic
995852056 5:116556613-116556635 TCTGGAGGTTGCTATTCTATTGG - Intronic
997164651 5:131646959-131646981 GCTGGAGGCTGTTATCATTTAGG - Intronic
998627814 5:143865361-143865383 GCTGGAGACTGTTTTTTTAGAGG + Intergenic
999100070 5:149016291-149016313 GCTGGAGGGTGTAAATGTAAGGG - Intronic
1000391618 5:160728634-160728656 ACTGAAAGCTGTTATTCTCATGG - Intronic
1001710596 5:173774838-173774860 GCTAGAGTCAGTTTTTCTAATGG + Intergenic
1001756762 5:174176334-174176356 GCTGGAGGCTGATATCCTGGTGG + Intronic
1004260964 6:14107386-14107408 GCTGAAAGCTGTTATACTCATGG - Intergenic
1004618712 6:17314559-17314581 TCTGGAGCCTGTTTTTATAAGGG - Intergenic
1004848006 6:19667169-19667191 GCTGTTGTCTGTTATTCCAATGG + Intergenic
1005117365 6:22353622-22353644 TCTGAAGGCTGTTATGCTCATGG - Intergenic
1008059194 6:46979103-46979125 ACTGAAAGCTGTTATACTAATGG + Intergenic
1008233896 6:49019889-49019911 GCTGGAGGCCATTATACTATTGG - Intergenic
1011842662 6:91520946-91520968 ACTGGAGGCCATTATTCTAAAGG - Intergenic
1012923220 6:105241437-105241459 ATTGGAGACTATTATTCTAAGGG + Intergenic
1015154590 6:130078087-130078109 CCTGGTCTCTGTTATTCTAATGG + Intronic
1017874621 6:158514562-158514584 GCTGGAGCTGGTTATTCCAAAGG - Intergenic
1018461865 6:164006219-164006241 GCTGGAGGCCATTATCCTAAGGG + Intergenic
1019710410 7:2515831-2515853 GCTGGAGTCTGCTAGTCTCAGGG + Intronic
1020148190 7:5661240-5661262 CCTGCAGGCTGTTTTTCGAAGGG + Intronic
1020491373 7:8788410-8788432 GCTGGAGGCCATTTTTCTAAGGG - Intergenic
1022226104 7:28365123-28365145 GTTTGAGACTGTTATTCTAGAGG - Intronic
1025606924 7:63046222-63046244 TCTGGAGAGTGTTATTCAAAGGG + Intergenic
1026222181 7:68409933-68409955 GCTGGGGGCTGGCATTGTAATGG - Intergenic
1028018081 7:85739797-85739819 GGTGGAGTCTGTTATTTTAAAGG + Intergenic
1029371218 7:100152001-100152023 GCTGGAAGAAGTTATTTTAAAGG + Intronic
1029872830 7:103713502-103713524 GCTAGAAGCTGTTACTCTCAGGG + Intronic
1030088109 7:105834606-105834628 GCTGAAGGGTGCTATTCTGATGG + Intronic
1031155040 7:118100288-118100310 GCTGGAGGCCATTATCCTAAAGG - Intergenic
1031385886 7:121150328-121150350 GCTGGAGGCCATCATCCTAAGGG - Intronic
1031598026 7:123670110-123670132 GCTGGAGGCTTGTATGCTCATGG + Intergenic
1032324091 7:130910278-130910300 GCTGGAGGATTTTTTGCTAATGG - Intergenic
1034216255 7:149408495-149408517 ACTGGAGACTATTATTCTAAGGG - Intergenic
1035166037 7:156990453-156990475 GCTTGAGGCTGTGATTCTGTGGG - Intergenic
1035679033 8:1474159-1474181 GTTGGAGACCATTATTCTAAGGG - Intergenic
1038366763 8:26943919-26943941 AATGGAGACTATTATTCTAAGGG - Intergenic
1038982521 8:32775449-32775471 GCTGGAGGCTGTTATCCTAAGGG - Intergenic
1039314224 8:36354050-36354072 ACTGGAGGCCATTATTCCAAGGG + Intergenic
1041017587 8:53607371-53607393 CCTGGAGGCCATTATCCTAAGGG + Intergenic
1042981089 8:74529492-74529514 GCTGCAAGCCATTATTCTAAGGG + Intergenic
1043835923 8:85045800-85045822 GCTTGAGGCTATAATCCTAAGGG - Intergenic
1044219606 8:89654043-89654065 TCTGGAGGCTGCAATTCTGAAGG - Intergenic
1044307585 8:90655906-90655928 GCTGGAGGCCATTATCCTGAGGG + Intronic
1044445917 8:92275403-92275425 TCTGGAAGCTTTTAGTCTAAGGG + Intergenic
1045161919 8:99557421-99557443 ACTGGTGGCCATTATTCTAAGGG - Intronic
1046722049 8:117631504-117631526 GCTGGAGGTCATTATCCTAAGGG + Intergenic
1047061367 8:121230481-121230503 ATTGGAGACTATTATTCTAAGGG - Intergenic
1047106091 8:121732023-121732045 GCTGGAGGCCATTATTCTAAGGG - Intergenic
1048638288 8:136323844-136323866 TCTGCAGGCTATTATTCTACAGG - Intergenic
1048845903 8:138603478-138603500 GCAGGAGGCTCCCATTCTAAGGG + Intronic
1049034561 8:140064335-140064357 GCTGGAGGTTGCCACTCTAAGGG + Intronic
1050999009 9:12256983-12257005 GCTGGAGTGTGTTATGCTAAGGG - Intergenic
1052009085 9:23384766-23384788 ACTGGAAGCTGTTATCCTCAGGG + Intergenic
1052664533 9:31477904-31477926 GCTAGAGGCCATTATCCTAAGGG + Intergenic
1055282857 9:74694883-74694905 GCTGGAGGATGATTTTCTCAAGG - Intergenic
1055306440 9:74934232-74934254 GCTGGAGGCCATTATTCTAAGGG + Intergenic
1056604090 9:88071262-88071284 GCTGCAGGTTTTTATTATAAAGG - Intergenic
1056742212 9:89267213-89267235 GCTAGAGGCCATTATTCTATGGG - Intergenic
1057510199 9:95672179-95672201 GCTGGAGGCCATTATCCTAAGGG + Intergenic
1058223263 9:102328523-102328545 GCTGGAGGCTATTACTTTAGAGG + Intergenic
1058441262 9:105009870-105009892 ACTGGAGGCCATTATCCTAAAGG - Intergenic
1061523067 9:131133265-131133287 GCTGGAGGCTTTGATTTCAAGGG + Intronic
1185554087 X:1006789-1006811 GCTGGAGGCCATGATTCTAAGGG - Intergenic
1185764821 X:2716800-2716822 GGTGGAGGCTGTAAGACTAAGGG - Intronic
1185917973 X:4057132-4057154 GCCAGAGGCCATTATTCTAAGGG - Intergenic
1186720224 X:12296330-12296352 GCTGGTGGCTGTGATTCTTGTGG - Intronic
1187217810 X:17294121-17294143 GCTGGAGGCCATTATCCAAAGGG + Intergenic
1187328004 X:18309641-18309663 GCTGGAGGCCATTACCCTAAAGG + Intronic
1187855523 X:23633000-23633022 ACTGGAGGCCATTATCCTAAGGG - Intergenic
1188678567 X:32973595-32973617 GCTGGAGGGTGGAATTCTGAAGG - Intronic
1188735689 X:33712175-33712197 ACTAGAGGCCGTTGTTCTAAGGG + Intergenic
1189300947 X:39951852-39951874 ACTGGAGGCTGACATTCTCATGG - Intergenic
1191057518 X:56257636-56257658 GCTAGAGGCTATTCTCCTAAGGG - Intronic
1191233810 X:58118324-58118346 GCTGGGGCCAGGTATTCTAATGG + Intergenic
1193480547 X:82022413-82022435 GGTGGTGGCAGTTATTCTAAAGG - Intergenic
1193501512 X:82281079-82281101 GCTTGAGGCTGTTTTTATCAGGG + Intergenic
1193550406 X:82885436-82885458 GCTGGAGGCCATAATTCTAAGGG + Intergenic
1193803603 X:85967584-85967606 GCTGCAGACTGTTTATCTAAAGG + Intronic
1193828094 X:86251616-86251638 ACTGGAGACTATTATTCTAACGG - Intronic
1194002449 X:88448193-88448215 TCAGGAGGCTGACATTCTAATGG + Intergenic
1194393944 X:93356486-93356508 ATTGGAGACTATTATTCTAAGGG - Intergenic
1194547234 X:95252249-95252271 ATTGGAGACTATTATTCTAAGGG - Intergenic
1195015331 X:100773945-100773967 GCTGGAGGCCATTATCCTAAGGG - Intergenic
1196039753 X:111189201-111189223 GCTGGAGGCCATTATTCTAAGGG - Intronic
1196268372 X:113680218-113680240 GCTGGAGGCCATTATTCTAAGGG - Intergenic
1197103906 X:122690200-122690222 GCTGGTGGTCATTATTCTAAGGG + Intergenic
1197570455 X:128144626-128144648 ACTGGAGGCCATTATTCTAGGGG + Intergenic
1197854854 X:130903329-130903351 GCTGGAGGCTGTTCTTCCTGGGG + Intergenic
1198115438 X:133540416-133540438 GCCGGAGGCCATTATTCTAAGGG + Intronic
1198452162 X:136777851-136777873 GGTGGAGACCATTATTCTAAGGG + Intronic
1198837740 X:140821963-140821985 GCTGGAGGCCATTATCCTATGGG - Intergenic
1199199729 X:145073372-145073394 GCTGGAAGGTATTATTTTAATGG - Intergenic
1199536758 X:148911478-148911500 GCTGGAGCCTTTTATTCTCAAGG - Intronic
1200278109 X:154752871-154752893 GCTGGAAGCTGTTGGTCAAAAGG + Intergenic
1200359727 X:155592058-155592080 CCTGGAGGATGTTATGTTAAGGG + Intronic
1201985906 Y:19964951-19964973 GCTGGAAGCCATGATTCTAAGGG - Intergenic