ID: 1131382607

View in Genome Browser
Species Human (GRCh38)
Location 15:91976183-91976205
Sequence TGTACTGGGGAGAAGATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131382596_1131382607 29 Left 1131382596 15:91976131-91976153 CCTGGGCTAGAAAGCAGAAATGG 0: 1
1: 0
2: 1
3: 18
4: 257
Right 1131382607 15:91976183-91976205 TGTACTGGGGAGAAGATAGATGG 0: 1
1: 0
2: 4
3: 35
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131382607 Original CRISPR TGTACTGGGGAGAAGATAGA TGG Intronic
900745424 1:4357401-4357423 TGTTCTTGCGAGAAGGTAGAGGG + Intergenic
900762593 1:4482960-4482982 CGTGCTGGGGAGAAGACGGAGGG + Intergenic
901105649 1:6754081-6754103 AGGACTGGGGATAAGACAGAGGG - Intergenic
901113216 1:6816315-6816337 TCTAGTGGGGGGAAGACAGATGG - Intronic
902710877 1:18238954-18238976 TCTTCTGGGGAAAAGATAGCGGG - Intronic
904286611 1:29456788-29456810 TGTCCTGGGGAGAGGATAAGGGG + Intergenic
905563526 1:38945483-38945505 TTCACTGGGGAAAAGATGGATGG + Intergenic
909152710 1:72028512-72028534 GGTAGGGGTGAGAAGATAGAGGG - Intronic
909576797 1:77184973-77184995 TGGCCTGGGCAGAAGACAGATGG + Intronic
909598127 1:77429828-77429850 AGAACTGGGGAGAAGAGAAAGGG + Intronic
910050971 1:82973581-82973603 TGTCCTTGGGATAAGGTAGAGGG + Intergenic
910450510 1:87338869-87338891 TGGACTCAGGAGCAGATAGAGGG + Intronic
910561796 1:88599113-88599135 TGGCCTGTGCAGAAGATAGATGG + Intergenic
911754509 1:101537361-101537383 TGTACTGGGGAGGGGTTACAAGG + Intergenic
913476799 1:119245657-119245679 TGTACTGGGGAGAAAAGAGTGGG - Intergenic
913588937 1:120303886-120303908 TACAATGGTGAGAAGATAGAGGG + Intergenic
913619248 1:120594483-120594505 TACAATGGTGAGAAGATAGAGGG - Intergenic
914570962 1:148915769-148915791 TACAGTGGTGAGAAGATAGAGGG + Intronic
914601870 1:149214502-149214524 TACAATGGTGAGAAGATAGAGGG - Intergenic
914905810 1:151742613-151742635 GTTCCTGGGGACAAGATAGATGG + Intergenic
915899565 1:159836651-159836673 GGAACTGGGGAGAAGAGGGAAGG - Exonic
916550709 1:165847432-165847454 TGGGCTGGGGTGAAGAAAGAAGG - Intronic
917659008 1:177159399-177159421 TGTAGTGGAGAGAAAAAAGAAGG + Intronic
917719635 1:177774883-177774905 TGTTCTGAGGACCAGATAGAAGG - Intergenic
920916682 1:210263268-210263290 TGCACTTGGGAGAAGGGAGAGGG - Intergenic
921064145 1:211610895-211610917 TAAAGTGGGGATAAGATAGATGG - Intergenic
921603641 1:217133711-217133733 AGTACTGAGGAAAAGAGAGAAGG - Intronic
923593985 1:235345997-235346019 TGTACTGAGAGGAAGAAAGAGGG + Intergenic
924178503 1:241417625-241417647 TGGACTGGAGAGAAGAAATAGGG - Intergenic
924459388 1:244244863-244244885 TGTTCTTGGGAGAAGAGGGAAGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064095942 10:12424559-12424581 TGGACTGGGGCCAAGATAGAAGG - Intronic
1065818083 10:29500188-29500210 TGTATTGGGGAGAAGAGTGTAGG + Intronic
1065921461 10:30397048-30397070 AGTCCTGAGAAGAAGATAGAAGG - Intergenic
1066198066 10:33120955-33120977 TGTAGTTGCCAGAAGATAGAGGG - Intergenic
1066361195 10:34733026-34733048 TGTAGAGGGCAGAAGAGAGAGGG - Intronic
1066543612 10:36475602-36475624 TGGCCTGTGCAGAAGATAGATGG + Intergenic
1067973862 10:51001745-51001767 TACGGTGGGGAGAAGATAGAGGG + Intronic
1068256117 10:54513977-54513999 TGCTCTAGGGAGAAGACAGATGG - Intronic
1073957779 10:108892522-108892544 TGGCCTGTGCAGAAGATAGATGG - Intergenic
1074435504 10:113430927-113430949 TGTATTGGAGAGAAGAGAAAAGG + Intergenic
1074891911 10:117742957-117742979 TGACCAGGGGAGAAGATAGTGGG + Intergenic
1077025806 11:439380-439402 TGGACTGGGAAGAGGATGGATGG - Intronic
1078226813 11:9399649-9399671 TCATCTGGGGAGAAGAAAGATGG + Intronic
1078303280 11:10156310-10156332 TGGCCTGGGGTGAAGACAGATGG + Intronic
1080512734 11:32991047-32991069 TGTACTGAAGGGAAGTTAGATGG - Intronic
1083027240 11:59561036-59561058 TGTACAGGGGAGAAGTGGGAGGG - Intergenic
1083611479 11:64006446-64006468 TGCCCGGGGGAGAAGATGGATGG + Intronic
1083622594 11:64056479-64056501 TGTACTAGAGAGAAGACAGACGG + Intronic
1083647873 11:64183600-64183622 GCTGCTGGGGAGAAGATGGAAGG + Intergenic
1085249442 11:75132643-75132665 TGTTCTGGGGGGAAGAGAGGTGG + Intronic
1085348032 11:75780671-75780693 TGTTGTGGGGAGCAGAGAGAAGG + Intronic
1085462544 11:76702785-76702807 TGCAATGGGGTGAACATAGAGGG - Intergenic
1086093496 11:83027385-83027407 GGTACTCGGGAGAAGAAACATGG - Intronic
1087934733 11:104019030-104019052 TTTCCTGGTGAGGAGATAGAGGG - Intronic
1087981773 11:104623037-104623059 TACACTGGGGAGAAGATAGCTGG - Intergenic
1088246438 11:107822506-107822528 TGTTCTGGGGAGAAGAAAGAGGG - Intronic
1088725206 11:112628511-112628533 TCTGCTGGGGACAAGAAAGAAGG - Intergenic
1088856189 11:113756344-113756366 TATACTGGTGATAAGATATAGGG + Intronic
1089872996 11:121693401-121693423 AGTGCTGGGGAATAGATAGATGG - Intergenic
1089949212 11:122509849-122509871 TGTCCTTGGGACAAGCTAGAGGG - Intergenic
1091100295 11:132866052-132866074 TTTCCTGAGGAGAAGAGAGAAGG - Intronic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1091211420 11:133864448-133864470 TGTGCTGGGGAGAAGAGACCTGG - Intergenic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1093410822 12:18864699-18864721 TGTAGTGGGAAGAAAATGGAAGG - Intergenic
1093537825 12:20243759-20243781 TGCACTGGGGAGAAGGGAAATGG + Intergenic
1093963385 12:25300561-25300583 TGAACTGGGGAGAAGAGGGTGGG - Intergenic
1094200167 12:27787050-27787072 TGCACTCTGGAGAAGATAGTGGG + Intronic
1095659817 12:44718344-44718366 TCTACTGGGGAGAGGTTAGAAGG - Intronic
1095841581 12:46699830-46699852 AGTAGTGGGGAGAAAATAGATGG + Intergenic
1096422783 12:51474639-51474661 TGTAGGGGGGAGAAAAGAGAAGG - Intronic
1097279542 12:57836188-57836210 TGGACTTGGGAGAAGGTATAGGG - Intronic
1100024469 12:90111015-90111037 TGAATTGAAGAGAAGATAGAAGG + Intergenic
1100384740 12:94095335-94095357 GCTACTGGGGAGAAGAATGAGGG + Intergenic
1100435625 12:94568985-94569007 GTCACTGGGGAGAAGATACACGG + Exonic
1100731450 12:97474969-97474991 TTTATTGGGGAAAAGACAGAAGG - Intergenic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1101288165 12:103337742-103337764 TGTTCTGAGGAGAATAGAGAAGG - Intronic
1102643518 12:114387754-114387776 TGTGGTGGGGAGAAGCTATAGGG + Intronic
1106008444 13:25794080-25794102 TGAGATGGGGAGAAGACAGAGGG + Intronic
1106245079 13:27942298-27942320 TATACAGGGGAGAATATAGATGG + Intergenic
1107263581 13:38524688-38524710 TGTACTTGGGACCAGAAAGAAGG - Intergenic
1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG + Intronic
1108359478 13:49656218-49656240 TGTGATGGGCAGAGGATAGAAGG + Intergenic
1109700188 13:66014815-66014837 TGTACTTGGCACAAGATAGAAGG - Intergenic
1109951139 13:69503121-69503143 TGGCCTGTGGAGAAGACAGATGG - Intergenic
1110796364 13:79643273-79643295 TGTAGTGGGGAAAAAAGAGAAGG - Intergenic
1111192416 13:84826693-84826715 TGTACTTGGGAAAAGGAAGAAGG - Intergenic
1111440966 13:88282228-88282250 TGGCCTGTGGAGAAGACAGATGG + Intergenic
1112019021 13:95355626-95355648 TGTCCAGGGGAGAAATTAGAAGG - Intergenic
1112158611 13:96845602-96845624 TGTACAGGGGACAAGAAAGGTGG - Intergenic
1113106062 13:106772651-106772673 TGTGCAGGGGAGAACAGAGAGGG - Intergenic
1113993494 14:16048215-16048237 TGTAGTGGTGAGAAGGTAGATGG + Intergenic
1115488576 14:33936974-33936996 TGAACAAGGGAGATGATAGAAGG - Intronic
1116871022 14:50069341-50069363 TGAACTGAGCAGAAGAGAGACGG - Intergenic
1117974870 14:61287386-61287408 TGTACTGGAAAGAAGAGAGGGGG + Intronic
1118099453 14:62580322-62580344 TGTGAAGGGGAGAAGATAAAAGG - Intergenic
1118894443 14:69934174-69934196 TGTACTGGGCAGAAAATGCAAGG - Intronic
1119021670 14:71121509-71121531 TGGACTTTGGAGAAGAGAGATGG + Intergenic
1119474837 14:74921187-74921209 TGGACAGGGGACAAGACAGATGG + Intronic
1121871026 14:97407471-97407493 AGTACTGGGAGGAAGATAAAGGG + Intergenic
1122294572 14:100698056-100698078 AGTACTGGGGAGAGGACCGAAGG + Intergenic
1123981405 15:25607994-25608016 TCTTGTGGGGAGAAGACAGATGG - Intergenic
1124509501 15:30311190-30311212 TGGACTGTGCAGAAGACAGATGG + Intergenic
1124734059 15:32227472-32227494 TGGACTGTGCAGAAGACAGATGG - Intergenic
1126689560 15:51278728-51278750 AGTACAGGAGAGAAAATAGAAGG - Intronic
1128734332 15:70044267-70044289 AGGAATGGGGAGAAGATGGAAGG - Intergenic
1130199449 15:81811324-81811346 TGTGCTGGGGAGGAGAGAGGAGG - Intergenic
1130749862 15:86700037-86700059 TGAAATGGGGAGAAGAGGGAAGG - Intronic
1130888374 15:88112483-88112505 TGGGGTGGGGAGAAGACAGAAGG + Intronic
1131382607 15:91976183-91976205 TGTACTGGGGAGAAGATAGATGG + Intronic
1131733236 15:95304268-95304290 TGTTCTGGGGAGCAGAAAGCCGG + Intergenic
1132170129 15:99642141-99642163 TGTTCTGGGGAAAAGAAATAGGG - Intronic
1133670062 16:8009851-8009873 TGTACTAGGGTAAAGAGAGATGG - Intergenic
1135052889 16:19206755-19206777 TGAAATGGGGAGAAGAAACATGG - Intronic
1135358675 16:21792366-21792388 TGTAAAGGGGGCAAGATAGAGGG + Intergenic
1135457231 16:22608802-22608824 TGTAAAGGGGGCAAGATAGAGGG + Intergenic
1136096470 16:27960635-27960657 TGTGGTGGGGAGAAAATGGATGG + Intronic
1137833623 16:51569231-51569253 AGTACTGGGAATAAAATAGAGGG + Intergenic
1139692599 16:68650722-68650744 TGTGCTGGGGAGAAGAGACCTGG - Intronic
1139925399 16:70483103-70483125 TGTGGTGGGGAGAGGAGAGAGGG - Intronic
1139939199 16:70592312-70592334 TGCACTGGGGAGAAGAACGAGGG - Intronic
1141559653 16:84858948-84858970 TGGCCTGTGCAGAAGATAGATGG - Intronic
1142108147 16:88317300-88317322 TGCCCTGGGGAGAAGGCAGAAGG - Intergenic
1142254373 16:89006815-89006837 GGGAGTGGGGAGGAGATAGAGGG - Intergenic
1142254508 16:89007182-89007204 GGGAGTGGGGAGAAGATGGAGGG - Intergenic
1143113132 17:4564546-4564568 TGTACAAGGCAGAAGACAGATGG + Intergenic
1143187493 17:5019460-5019482 TGTACTGAGGAGCAGCTAGATGG + Intronic
1143674576 17:8422483-8422505 AGTGCTGGGGACAAGATAAAGGG - Intronic
1144110754 17:12029433-12029455 TGTAATGGGGAAAATATAAATGG + Intronic
1146806763 17:35871161-35871183 TCCACTGGGGATAAGGTAGAGGG + Intergenic
1147895867 17:43750981-43751003 TGGACAAGGGAGAAGACAGAGGG + Intergenic
1147921693 17:43921106-43921128 TGTCCTGGCGACAAGGTAGAGGG + Intergenic
1148375544 17:47141915-47141937 TGTAGTGGTGAGAAGGTAGATGG + Exonic
1149556135 17:57574714-57574736 AGTAGTTGGTAGAAGATAGATGG - Intronic
1150070468 17:62146040-62146062 GGCACTGGGGAGAAAGTAGAAGG - Intergenic
1150439465 17:65179523-65179545 TTTCCTGGGGAGGAGAGAGAGGG + Intronic
1151221969 17:72619590-72619612 TGTTCTGGGGAGAAGAGAGAAGG - Intergenic
1151412553 17:73940959-73940981 AGTGCTGGGGAGGAGATAGAAGG + Intergenic
1151809106 17:76425957-76425979 TCTTGTGGGGAGGAGATAGAAGG - Intronic
1153543602 18:6183460-6183482 TGTCCTGAAGAGAAGACAGAGGG - Intronic
1156476292 18:37407768-37407790 TGTCCTGGAGAGCAGACAGAAGG - Intronic
1157182927 18:45513391-45513413 TGTATTGATGAGAAGTTAGAGGG + Intronic
1158187884 18:54792071-54792093 TGTCCTGGTGACAAGGTAGAGGG + Intronic
1158323851 18:56293324-56293346 TGTACAGGAGAGCAGAAAGATGG + Intergenic
1161757564 19:6145510-6145532 TCTACTGGGGAGGTGGTAGATGG - Intronic
1162855249 19:13463109-13463131 TATCCTGGTTAGAAGATAGATGG + Intronic
1163410755 19:17152850-17152872 AGGTCTGGGGAGAAGATGGATGG - Intronic
1163818606 19:19483169-19483191 TGTACTGGGGAAAGGAGAGCAGG + Intronic
1167387522 19:49172556-49172578 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387531 19:49172630-49172652 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387542 19:49172704-49172726 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387550 19:49172768-49172790 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387579 19:49172972-49172994 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387587 19:49173036-49173058 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387595 19:49173100-49173122 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387603 19:49173174-49173196 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387612 19:49173248-49173270 TGGACAGGTGAGAAGATGGATGG - Intronic
1167387623 19:49173322-49173344 TGGACAGGTGAGAAGATGGATGG - Intronic
1167549622 19:50151201-50151223 AGTAGTGGGGAAAAGGTAGAAGG - Intergenic
1168115776 19:54220827-54220849 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168118760 19:54240573-54240595 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168125091 19:54278559-54278581 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168136572 19:54356004-54356026 TGTCTTGGGGAGAAAATACATGG + Exonic
1168172168 19:54596170-54596192 TGTCCTGGAGAGAAGAAGGATGG - Exonic
1168176891 19:54632997-54633019 TGTCCTGGAGAGAAGAAGGATGG - Exonic
1168182610 19:54672329-54672351 TGTCCTGGAGAGAAGAAGGATGG - Intronic
1168185710 19:54698176-54698198 TGTCCTGGACAGAAGACAGATGG - Intronic
1168187681 19:54710088-54710110 TGTCCTGGAGAGAAGAAGGATGG - Intergenic
925499514 2:4487814-4487836 TGACCTGTGCAGAAGATAGATGG - Intergenic
925806742 2:7658431-7658453 TGTCCTTGTGAGAAGGTAGAGGG - Intergenic
926895191 2:17679343-17679365 TGTAATGGTGACAAGATAAATGG + Intronic
926938766 2:18113903-18113925 GTTACTGGGGAGAAGGCAGATGG + Intronic
927690494 2:25204624-25204646 TGCTCTGGGGAGAAGGTAGCCGG + Intergenic
928137561 2:28699648-28699670 TGTAGTGGGAAGGAGATTGATGG - Intergenic
928819495 2:35343163-35343185 TGAACTGGGGGAAAGATACAAGG + Intergenic
929346286 2:40888345-40888367 TGTATAGGTGAGAGGATAGATGG + Intergenic
930103033 2:47617798-47617820 TGTGCTGGGGAGACGAGTGATGG + Intergenic
930454039 2:51582038-51582060 TGTCCTTGAGACAAGATAGATGG + Intergenic
930456385 2:51612688-51612710 TGGCCTGTGCAGAAGATAGATGG - Intergenic
930843990 2:55881124-55881146 TGTACTGTGGAGATGATACTAGG - Intronic
931449939 2:62360108-62360130 TGTACTTCGGGGAAGAAAGAGGG + Intergenic
931910709 2:66896795-66896817 TGTGCTGGGGTGGAGATAAAGGG + Intergenic
934488386 2:94738524-94738546 TGTGCTGGGGAGAAGAGACCTGG + Intergenic
935088282 2:99869597-99869619 TGTACTGGGCTGGAGATAAATGG - Intronic
935543640 2:104378143-104378165 TGTCCTTGTGACAAGATAGAGGG - Intergenic
935564432 2:104591168-104591190 TGGCCTGTGTAGAAGATAGATGG - Intergenic
935612458 2:105039019-105039041 TGTACTGAGGAGTAGGCAGAGGG + Intronic
936293945 2:111250802-111250824 TGTATCAGGGAGAAGAAAGATGG - Intergenic
937615676 2:123919470-123919492 TCTACTAGGGACAATATAGATGG + Intergenic
938538192 2:132262649-132262671 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
939788786 2:146546990-146547012 TGTCCTGTGCAGAAGACAGATGG - Intergenic
940606036 2:155925266-155925288 TGTCCTGTGCAGAAGACAGATGG - Intergenic
941297975 2:163764218-163764240 TGTACTGGGAAAAATATAGATGG - Intergenic
941653566 2:168119524-168119546 TTTACTGGGCAGGAGATTGAAGG - Intronic
942015629 2:171811637-171811659 TGTATTAGGGAGAAGATTGTAGG - Intronic
946827797 2:223696401-223696423 AGCACTGGGGAGAGGAAAGAAGG - Intergenic
947743199 2:232494355-232494377 TGTGCAGGGGAGGAGACAGAGGG + Intergenic
948674738 2:239590193-239590215 TGCATTGGGGAGAAGCTGGAGGG + Intergenic
1168943395 20:1732068-1732090 TGCACAGGGGAGGTGATAGAAGG + Intergenic
1170134188 20:13055091-13055113 TGTACAGAAGATAAGATAGAAGG + Intronic
1170434221 20:16308567-16308589 TGTCTTGGGGAGGAGAAAGAGGG - Intronic
1170735879 20:19013805-19013827 TGTCCTGGGGAGAACTAAGAGGG + Intergenic
1171152727 20:22842137-22842159 TGGAGTGGGGAGAACAGAGAAGG - Intergenic
1171811540 20:29747644-29747666 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1171867094 20:30494436-30494458 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1171908132 20:30918094-30918116 TGTAGTGGTGAGAAGGTAAATGG + Intergenic
1171947137 20:31388759-31388781 TGGACTGGGGAGAACATGGTGGG - Intronic
1174643430 20:52064993-52065015 TGTGCTGGGGAGGAGGGAGAAGG + Intronic
1174698064 20:52580192-52580214 TATGCAGGGGAGAAGAGAGAGGG + Intergenic
1175876431 20:62232386-62232408 TGTTCTGGGGAAGAGATGGAGGG - Intronic
1175907967 20:62391111-62391133 TCTGCAGGGGAGAAGAGAGAAGG + Exonic
1175994868 20:62807518-62807540 TGGACTGGGAAGAAAAGAGATGG - Exonic
1176014081 20:62919793-62919815 TGCACTAGGAAGTAGATAGAGGG - Intronic
1176553432 21:8241533-8241555 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1176572354 21:8424557-8424579 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1176580263 21:8469117-8469139 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1177639885 21:23833101-23833123 TGTCCTTGTGACAAGATAGAGGG - Intergenic
1177879469 21:26674583-26674605 GGCACTGGGGACAAGTTAGAGGG + Intergenic
1178012515 21:28304018-28304040 TGGCCTGTGCAGAAGATAGATGG + Intergenic
1179033193 21:37737878-37737900 TGAACTTGGAAGGAGATAGAAGG + Intronic
1180313775 22:11259298-11259320 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1180341569 22:11624257-11624279 TGTAGTGGTGAGAAGGTAAATGG + Intergenic
1181367550 22:22389854-22389876 TGGCCTGTGCAGAAGATAGATGG - Intergenic
1181456232 22:23061611-23061633 TGTGCTGGGGAGAAGAGGGAGGG + Intronic
1182397335 22:30045975-30045997 TGTGCTGGGGAGAAGAGACCTGG - Intergenic
1183971443 22:41480528-41480550 TGTACTGGGGAGAGGATTACGGG - Intronic
1184934423 22:47710329-47710351 AGCACTGGGGAGAAGACAGGGGG - Intergenic
1203258430 22_KI270733v1_random:158561-158583 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
950545781 3:13637194-13637216 TGCACTGGGAAGAAGGGAGAAGG + Intronic
951586729 3:24222413-24222435 AGTAGTGGGGAGAAGAGGGAGGG + Intronic
951615503 3:24538868-24538890 TGTACTGCTTAGAAGATAGAGGG - Intergenic
951964829 3:28370550-28370572 ACTATTGGGGAGAAGAAAGACGG + Intronic
951983858 3:28596175-28596197 AACACTGGGGAGAAAATAGATGG - Intergenic
952672431 3:35986435-35986457 AATACTGGGAAGAAAATAGAGGG - Intergenic
952714114 3:36461462-36461484 TTAACTGGGGAGACGATGGATGG + Intronic
952751729 3:36830514-36830536 TCTTCTGTGGAGAAGATACAGGG - Intronic
953996594 3:47524549-47524571 TGAACTGGGAAGGAGAAAGAAGG - Intergenic
958508312 3:95011621-95011643 TTTACTGCAGAGAAGATAGTGGG + Intergenic
958632449 3:96700910-96700932 TGAACTGGGGAAAAGATATAAGG + Intergenic
959202265 3:103261918-103261940 TCTTCTGGGTGGAAGATAGATGG - Intergenic
960877839 3:122314908-122314930 TGTCCTGAAGAGAAGAGAGAGGG + Intergenic
962214758 3:133511663-133511685 TGTCCTGTGTAGAAGACAGAAGG + Intergenic
963057681 3:141200765-141200787 TGGATTGGTGAGTAGATAGATGG + Intergenic
963110363 3:141683177-141683199 TGCACTGGTGGGAAGAGAGAAGG + Intergenic
963500758 3:146122439-146122461 TGTAGTGGAAAGAACATAGAGGG - Intronic
965747877 3:171944435-171944457 TGTACTTGGGAGAAGATAATCGG + Intergenic
966102075 3:176282437-176282459 AGTTTTGGGGAGAACATAGATGG - Intergenic
966781662 3:183589481-183589503 TTTACTGGGGAGCACTTAGAAGG - Intergenic
967217269 3:187221031-187221053 TGTGCTGGGGAGAAGGAAGGTGG - Intronic
967564594 3:190959039-190959061 TGAACTGGAGAGAAGATTTAGGG + Intergenic
967807712 3:193730158-193730180 TGCTCTGGGAAGAGGATAGATGG + Intergenic
968557653 4:1255689-1255711 TGCACTGGGGAGAAGGAGGAGGG - Intergenic
970089291 4:12387253-12387275 TGGACTGTGCAGAAGAGAGATGG - Intergenic
971331869 4:25688318-25688340 TGCACTGGGGACTAGATTGAGGG - Intergenic
973668976 4:53194801-53194823 TGTACTGGGTTGGAGACAGAAGG - Intronic
975281351 4:72567087-72567109 TGTACTTGGAAGATGATGGAGGG - Intronic
976043895 4:80921340-80921362 AGTACAGAGGAGAACATAGAAGG + Intronic
977007310 4:91585318-91585340 TGAAATGGGGAAAAGAGAGAAGG - Intronic
979993176 4:127400053-127400075 TTTACTGGAAATAAGATAGATGG - Intergenic
980572614 4:134640384-134640406 TGTACAGGGGAGAAGAGGTAAGG + Intergenic
981272370 4:142859983-142860005 TTGACTGGTGAGAAAATAGATGG - Intergenic
982709331 4:158744467-158744489 TCTTCTAGGGAGAAGAGAGAAGG + Intergenic
983491994 4:168399230-168399252 TGAGCTGGAGAGAAGAGAGAAGG + Intronic
984620653 4:181948782-181948804 TGCACTGGGGTGAAGACAGTGGG - Intergenic
986445096 5:7814699-7814721 GGGACGGGTGAGAAGATAGATGG - Intronic
986937323 5:12905190-12905212 TGGCCTGTGCAGAAGATAGATGG + Intergenic
987817993 5:22929080-22929102 TGTAAGGGAGAGAAGGTAGAGGG - Intergenic
988857458 5:35242710-35242732 TGTCCTTGGGAGAAAAGAGAGGG - Intergenic
989085273 5:37669654-37669676 TTTACTGGGGAGTACCTAGAAGG + Intronic
990922215 5:60979804-60979826 TGGACTTGAGAGAACATAGATGG + Intronic
991280137 5:64904151-64904173 TGTAGTGGGCAGAAGCTGGAAGG - Intronic
991406038 5:66301961-66301983 GGTAATGGGGAGAAAATGGAAGG + Intergenic
992143687 5:73824097-73824119 GGTACTGGGAAGAAGATATCAGG - Intronic
992737948 5:79742614-79742636 TGGACTGGGGAGGAGACACAAGG - Intronic
993190533 5:84673962-84673984 TGGACTGGGGAGAAGACACTTGG + Intergenic
993221813 5:85108723-85108745 ACTACTGGGGAGTAGATATATGG + Intergenic
994265953 5:97717125-97717147 AGTAGTGGGGAGAAGAGAGAAGG + Intergenic
994958356 5:106563536-106563558 TGTACTGTTCAGAAGATAGATGG + Intergenic
995226286 5:109705033-109705055 GTTACTGGGGAGGAGACAGAAGG - Intronic
996065678 5:119076436-119076458 TTTGGTGGGGAGAATATAGAAGG + Intronic
996704115 5:126479372-126479394 TGTAGAGAGGAGAAGAAAGAAGG + Intronic
998210049 5:140189010-140189032 AATACTGAGGGGAAGATAGAAGG - Intronic
998231042 5:140361512-140361534 TGTTGTGGGGAGAAGATTCAGGG + Intronic
998508655 5:142693123-142693145 TCCACTGAGAAGAAGATAGATGG - Intronic
999191604 5:149751886-149751908 TGAGATGGGGAGAACATAGACGG + Intronic
1003171785 6:3726191-3726213 TGTCTTGGGGAGAAGACAGATGG - Intronic
1004478642 6:15998254-15998276 TGTACTTGGGAGGAGAGGGAGGG + Intergenic
1004755394 6:18605141-18605163 TGTAGTAGGGAGGAGAGAGAAGG + Intergenic
1005423427 6:25676421-25676443 AGGACTGGGGAGGAGATAAAAGG - Intronic
1005461211 6:26071688-26071710 TGTCCTTGGGACAAGGTAGACGG + Intergenic
1005525221 6:26640833-26640855 TTTTCTGGGGAGAAGGTACACGG + Intronic
1007368292 6:41409460-41409482 TGGAGTGGGGAGGAGAGAGAGGG + Intergenic
1007725861 6:43915232-43915254 TGTACTGGGGAATAGAGAGGTGG - Intergenic
1008321600 6:50120952-50120974 TGTAAAGGGGAGAAGAGAAATGG + Intergenic
1010796867 6:80126823-80126845 AGTACTAAGGTGAAGATAGAAGG + Intronic
1012500412 6:99881935-99881957 TGGACAGGGGAGAAGACAGAGGG + Intergenic
1013209707 6:107975385-107975407 TGGAATGGGGAGAAGATGGAAGG + Intergenic
1016083928 6:139889045-139889067 CTTACTGGGGAGAACAAAGACGG + Intergenic
1016443240 6:144106445-144106467 TGAAGTGGGGAGAAGTTTGAAGG + Intergenic
1016734168 6:147458183-147458205 GGAACTGGGGAGAAGATAATGGG - Intergenic
1017309804 6:152961877-152961899 TGTACTTGGGACAAGATTAAGGG - Intergenic
1017729896 6:157305946-157305968 TGTAAAGGGGAGCAGATAAATGG + Intronic
1018112553 6:160549340-160549362 TGTGCTTGGCAGAAGGTAGAAGG - Intronic
1018116101 6:160586909-160586931 TGTATTTGGCAGAAGGTAGAAGG - Intronic
1018752074 6:166815617-166815639 CATACTGGGGAGAAGAGAGGAGG - Intronic
1020836360 7:13156898-13156920 AGTACAGGGTAGAATATAGAAGG + Intergenic
1021245088 7:18251557-18251579 TGGACTTTGGAGAAGATGGAGGG + Intronic
1024576648 7:50769919-50769941 TTTACTGGGGGGAAGACTGAAGG - Intronic
1025744894 7:64233993-64234015 GCTACTGGGAAGAGGATAGAGGG + Intronic
1026081378 7:67224546-67224568 TGTTTTGGGGAGAAAAAAGAAGG - Intronic
1026695703 7:72589453-72589475 TGTTTTGGGGAGAAAAAAGAAGG + Intronic
1027230212 7:76267929-76267951 GGGGCTGGGGAGAAGATTGAGGG - Intronic
1028394465 7:90352158-90352180 GGTACTGGAGAGAAGAGAGTAGG + Intronic
1029038674 7:97549889-97549911 TGTCCTTGAGACAAGATAGAAGG + Intergenic
1029116608 7:98241015-98241037 TGTACTGGGGAGAAGGGTGAGGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1030606508 7:111644046-111644068 TTCACTGGGGAGAAGGGAGATGG - Intergenic
1031859940 7:126966994-126967016 TGTCCTGGGGAGATCAGAGAAGG - Intronic
1032442813 7:131955079-131955101 TGTCCTGGGAAGGAGAAAGAGGG + Intergenic
1032678896 7:134161647-134161669 TGTACCAGGGAAAATATAGAGGG + Intronic
1032923531 7:136576711-136576733 TGTCCTGTGCAGAAGACAGATGG - Intergenic
1034930108 7:155154768-155154790 TGTTCTGGGGAAAAGGAAGAGGG + Intergenic
1035054311 7:156023889-156023911 TGCAAAGGGGAGAAGAAAGAGGG + Intergenic
1036452546 8:8881525-8881547 TATAGTGGGGAGCATATAGATGG - Intronic
1037012231 8:13857414-13857436 TTTAGTGGTGAGAAGATAGTGGG + Intergenic
1038119327 8:24594433-24594455 TGTACTAGTGACAAGTTAGAAGG - Intergenic
1041043265 8:53867735-53867757 TGTCTTGGGGAAAAGAAAGAAGG - Intronic
1041724220 8:61003292-61003314 GGTTCTGGGGAGTGGATAGAGGG + Intergenic
1042188201 8:66157829-66157851 TGTACTTGGGTGAAGAGAGAAGG - Intronic
1042502203 8:69521811-69521833 TGTTGTGGGTAGATGATAGATGG + Intronic
1042784869 8:72536630-72536652 GGAACTGGGGCGAAGACAGATGG - Intergenic
1043225010 8:77715126-77715148 CTTGCTGGGGAGAAGATAAAGGG - Intergenic
1045709976 8:104971909-104971931 TGTTCTGGGGAGAATTTTGAAGG - Intronic
1045826261 8:106402187-106402209 TGATCTGTGGAGAAGACAGATGG - Intronic
1047135514 8:122073605-122073627 TGTTCTGGGGAGAAAAATGAGGG + Intergenic
1047718890 8:127620386-127620408 ACTAATGGGGAGAAGATGGAGGG + Intergenic
1047900539 8:129416824-129416846 TGCACTGGGGAGATGGCAGAAGG + Intergenic
1048798303 8:138172049-138172071 TGTTCTGTGGAGAATAAAGAGGG + Intronic
1048904398 8:139073901-139073923 AGTAATGGGGAGAAGAAAGGGGG + Intergenic
1049486737 8:142868818-142868840 TGGACTGAGCAGAAGATAGATGG - Intronic
1050319739 9:4439420-4439442 GGTACTGGGGAGAAGATAGGAGG - Intergenic
1051618861 9:19032198-19032220 TGCCCTGGGAAGCAGATAGAAGG + Intronic
1051859465 9:21607632-21607654 TGAACTGGGTAGGAGGTAGAAGG + Intergenic
1053578801 9:39381675-39381697 GGAACTGGGGAGAACACAGAGGG - Intergenic
1053669404 9:40345841-40345863 TGTGCTGGGGAGAAGAGACCTGG - Intergenic
1054100384 9:60940479-60940501 GGAACTGGGGAGAACACAGAGGG - Intergenic
1054380534 9:64485861-64485883 TGTGCTGGGGAGAAGAGACCTGG - Intergenic
1054515212 9:66030450-66030472 TGTGCTGGGGAGAAGAGACCTGG + Intergenic
1054585961 9:66966407-66966429 GGAACTGGGGAGAACACAGAGGG + Intergenic
1055320583 9:75080067-75080089 TGGGCTGGGGAGAAGTTAAAAGG + Intronic
1055389515 9:75804644-75804666 TGTACTAGGAAGATGAGAGAAGG - Intergenic
1055693490 9:78858406-78858428 TGGGATGGGGAGAAGAAAGAGGG - Intergenic
1056031372 9:82557058-82557080 TGTGCTGGTGAGAAGTTAGCCGG - Intergenic
1057058911 9:91985699-91985721 TGGACTGTGCAGAAGACAGATGG + Intergenic
1057931448 9:99196995-99197017 TGTAGTGGTGAGAAGAGAGAAGG + Intergenic
1058019781 9:100075166-100075188 TGGCCTGTGCAGAAGATAGATGG + Intronic
1059705434 9:116818999-116819021 TTTACTGGTGAGAAAATGGAAGG + Intronic
1060321378 9:122564586-122564608 TGGCCTGTGCAGAAGATAGATGG + Intergenic
1203474624 Un_GL000220v1:140577-140599 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1203362161 Un_KI270442v1:225509-225531 TATAGTGGTGAGAAGGTAGATGG - Intergenic
1186908299 X:14134648-14134670 TATACTGGCAAGAAGATAGCTGG - Intergenic
1189227728 X:39427299-39427321 TGTGCTGGGGAGAAGGTAGAAGG + Intergenic
1190224020 X:48531836-48531858 TGTTCTGGTGAGAAGACAAAGGG - Intergenic
1192116576 X:68417412-68417434 AGTCCTGGGCAGAAGAGAGAGGG - Intronic
1192198948 X:69051722-69051744 TGGACTGAGGAGCAGGTAGATGG - Intergenic
1192605996 X:72518490-72518512 TGTGCAGGGAAGAAGATATATGG - Intronic
1193226702 X:78992286-78992308 TGGACTGTGAAGAAGAGAGATGG - Intergenic
1194284237 X:91989876-91989898 AGTTCTGGAGAGAAGAAAGAGGG - Intronic
1195133643 X:101880377-101880399 TGAACTGGGTAGAAGATACAGGG - Intergenic
1196097782 X:111818071-111818093 TTTACTGGGGAAATGATAGAGGG - Intronic
1196978033 X:121181233-121181255 TTTTCTGGGGAGAAGATCCATGG + Intergenic
1197245159 X:124159910-124159932 TGGCCTGGGCAGAAGACAGATGG - Intronic
1197425848 X:126296529-126296551 TGGACTGTGCAGAAAATAGATGG - Intergenic
1197647380 X:129032876-129032898 AGGACTGGGGACAGGATAGAGGG - Intergenic
1198135730 X:133748558-133748580 TGTGTTGGGGGGAAGAGAGATGG - Intronic
1198860472 X:141063750-141063772 GGTACTGGGGAGGAGAGATAGGG + Intergenic
1198902218 X:141523640-141523662 GGTACTGGGGAGGAGAGATAGGG - Intergenic
1199318451 X:146409551-146409573 GATGCTGGGGAGAAGATGGAGGG + Intergenic
1199718118 X:150521658-150521680 TGTATTTGGGAGAAGAAAGAGGG + Intergenic
1200601803 Y:5214434-5214456 AGTTCTGGAGAGAAGAAAGAGGG - Intronic
1200906856 Y:8492510-8492532 TATACTTGAGAGAAGATAAAAGG + Intergenic
1200973211 Y:9178623-9178645 TGGACTGTGTAGAAGACAGATGG - Intergenic
1201076154 Y:10190813-10190835 TGTAGTGGTGAGAAGGTAGATGG + Intergenic
1201618844 Y:15932255-15932277 TGAAATGGAGAGAAGAGAGAAGG - Intergenic
1202137865 Y:21685890-21685912 TGGACTGTGTAGAAGACAGATGG + Intergenic