ID: 1131383881

View in Genome Browser
Species Human (GRCh38)
Location 15:91986468-91986490
Sequence CTGCATACTTTAAAAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 1, 2: 8, 3: 79, 4: 885}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131383881 Original CRISPR CTGCATACTTTAAAAAAAAA TGG (reversed) Intronic
901098195 1:6699745-6699767 AAGTATAATTTAAAAAAAAAAGG + Intronic
901249413 1:7764112-7764134 ATGCATACTTGATAAATAAATGG - Intronic
901375579 1:8836001-8836023 GTGCACATTTTAAGAAAAAAAGG + Intergenic
901385778 1:8908085-8908107 CTGAGTAATTTAAAAGAAAAAGG + Intergenic
904085588 1:27905028-27905050 CTGCACAATTGAAAAATAAAAGG + Intronic
906010260 1:42516764-42516786 CTGGATAATTTATAAAGAAAAGG - Intronic
907071399 1:51538694-51538716 CAGCATATTTACAAAAAAAAAGG - Intergenic
907479353 1:54734070-54734092 CTCAAAAATTTAAAAAAAAAAGG - Intronic
907754213 1:57294464-57294486 ATGCTTTGTTTAAAAAAAAAAGG - Intronic
907765937 1:57410555-57410577 TTGCTTTCTTTAAAAAATAAAGG - Intronic
907791135 1:57665315-57665337 TAGCATAGTTTAAATAAAAAGGG + Intronic
907960634 1:59277388-59277410 CTGAATTCTATTAAAAAAAATGG + Intergenic
908028742 1:59977507-59977529 CTCTGTCCTTTAAAAAAAAAAGG - Intergenic
908133535 1:61102159-61102181 CTGAACACTGTAAATAAAAATGG + Intronic
908375688 1:63537666-63537688 ATACATACTTAAAAAATAAAAGG - Intronic
908492198 1:64656783-64656805 TTGGAGACTTAAAAAAAAAAAGG + Intronic
908601652 1:65745599-65745621 CTGCATAATTTATAAATAAAAGG - Intergenic
908862808 1:68508507-68508529 CTGAAGATTTTAAAAAGAAAAGG - Intergenic
909145576 1:71926336-71926358 CTGAAAACTTGAAAAAAAAAAGG + Intronic
909262951 1:73518295-73518317 CTGCTGACTTTAAAATAACATGG + Intergenic
909624942 1:77705107-77705129 ATGCTTTGTTTAAAAAAAAAAGG + Intronic
909713278 1:78676436-78676458 CTGCATACTTAAATAAGAAAAGG - Intergenic
909734581 1:78941560-78941582 TTGCACATTTAAAAAAAAAAGGG - Intronic
909751201 1:79163890-79163912 CTGCAAACTTAGAAAATAAATGG - Intergenic
910676876 1:89823381-89823403 CTGCATAATATAAAAATTAAGGG - Intronic
910784233 1:90977033-90977055 TTAAATACTTAAAAAAAAAAAGG + Intronic
911043873 1:93612901-93612923 CTGTATATTTTTAAACAAAAAGG + Intronic
911555870 1:99343689-99343711 CAGTATAATTAAAAAAAAAAAGG + Intergenic
912283283 1:108340639-108340661 CTGCTTTCTTTAAAATAAATGGG - Intergenic
912332628 1:108833677-108833699 TTTTATAATTTAAAAAAAAAGGG + Intronic
912457795 1:109809281-109809303 TTACTTCCTTTAAAAAAAAAAGG - Intergenic
913282164 1:117196593-117196615 CTGTACTCTTAAAAAAAAAAAGG - Intronic
913396059 1:118374145-118374167 CTGCACACTTTAAAACAACCAGG - Intergenic
913540795 1:119818879-119818901 AAGTATAATTTAAAAAAAAAAGG - Intergenic
914361026 1:146936555-146936577 TCACATACTTTAAAATAAAAAGG + Intergenic
914406991 1:147385337-147385359 CCCAATACTTCAAAAAAAAAAGG + Intergenic
914491562 1:148154077-148154099 TCACATACTTTAAAATAAAAAGG - Intergenic
914549890 1:148704310-148704332 CTGCAAACAAAAAAAAAAAAAGG - Intergenic
914736283 1:150420244-150420266 TTACATGGTTTAAAAAAAAAAGG - Intronic
915831268 1:159132950-159132972 CTACTTACTTTAAAAGAAGAAGG + Intronic
916001078 1:160616374-160616396 GTGCCTTCTTAAAAAAAAAAAGG + Intronic
916292932 1:163186369-163186391 CTGCAATCTTTAAAAAGAAATGG - Intronic
916600893 1:166292558-166292580 CTGTACATTTTAAAATAAAATGG + Intergenic
916710435 1:167401030-167401052 AAGCAAACTTTTAAAAAAAACGG - Intronic
916758209 1:167793222-167793244 CTGCATACTTTTAAACAAACAGG - Intergenic
917005054 1:170405866-170405888 CTCCCCATTTTAAAAAAAAATGG + Intergenic
917197685 1:172483724-172483746 CTTAATACTTCAAGAAAAAATGG + Intergenic
917698109 1:177550366-177550388 CTGTATACTAAAAAAAAAAAGGG - Intergenic
917761267 1:178161103-178161125 TCAAATACTTTAAAAAAAAAAGG + Intronic
917766302 1:178221373-178221395 ATGCATATCTTAAAAAAAGAAGG - Intronic
918036444 1:180877732-180877754 ATGCTTATCTTAAAAAAAAAAGG + Intronic
918401904 1:184172090-184172112 CTGCATCCATTAAATTAAAAAGG - Intergenic
918429595 1:184445138-184445160 CTGCAAAGTGTAAAAAATAAGGG - Intronic
919107652 1:193173373-193173395 TTAAATACTTTAGAAAAAAAAGG - Intronic
919109860 1:193205206-193205228 CTGATGAGTTTAAAAAAAAAGGG - Intronic
920956494 1:210624330-210624352 CTGTATAATTTATAAAGAAATGG - Intronic
921368920 1:214402101-214402123 CTTCATTATTAAAAAAAAAAAGG + Intronic
921881605 1:220261060-220261082 TTACATACTTTAAAAAAAAGGGG + Intronic
923065633 1:230514694-230514716 CTGGATAATGTATAAAAAAAAGG - Intergenic
923128624 1:231055668-231055690 CTGTATACTTTATAAACAACAGG + Intergenic
923293626 1:232571912-232571934 CTGGATAATTTACAAAGAAAAGG - Intergenic
923351593 1:233112630-233112652 CTGCAAACTTTTTAAAAAGATGG + Intronic
923446457 1:234076289-234076311 AAGCATATTTTAAAAGAAAAAGG + Intronic
923548887 1:234945705-234945727 CTGCATAATTTAAAACATTATGG + Intergenic
923591632 1:235325356-235325378 CAGACTACTTAAAAAAAAAAAGG + Intronic
924478883 1:244408633-244408655 CTCCTTTCTTGAAAAAAAAAAGG - Exonic
1063155350 10:3374156-3374178 CTGTATATTTTAAAACTAAATGG + Intergenic
1063245983 10:4218987-4219009 TTGCCTTCTTTAAAAAAAGATGG - Intergenic
1063551899 10:7041514-7041536 CTGCAGACTTTAACATAGAAAGG - Intergenic
1063588386 10:7373367-7373389 CTGCATAATTTATAAAGAAAAGG - Intronic
1064851952 10:19718263-19718285 CTGGATAATTTATAAAGAAAAGG + Intronic
1065183162 10:23146766-23146788 CTGCATACTTAAAAGCAAGAAGG - Intergenic
1065213686 10:23429512-23429534 ATACTGACTTTAAAAAAAAAGGG - Intergenic
1065417364 10:25502861-25502883 CTGGTTCCTTTACAAAAAAAGGG + Intronic
1065445071 10:25789716-25789738 CTACACACTTGAAGAAAAAAGGG + Intergenic
1065699647 10:28412291-28412313 CTGCATCCTTTAAAAAGAAATGG + Intergenic
1065802423 10:29365006-29365028 TTGCATAATTTAAAAGAATAAGG - Intergenic
1066097604 10:32087100-32087122 ACTCATACTTAAAAAAAAAAAGG - Intergenic
1066237628 10:33501847-33501869 CTCCATCTTTAAAAAAAAAAAGG + Intergenic
1066842043 10:39935641-39935663 TTGCAGACTTTACAAAAATAGGG - Intergenic
1067066711 10:43108021-43108043 CTGGGTAACTTAAAAAAAAAAGG + Intronic
1067157964 10:43798735-43798757 CTGCATATATTAAAGACAAAAGG - Intergenic
1067344249 10:45426519-45426541 CTGCACATTTTAAAAAACAATGG - Intronic
1067460921 10:46457977-46457999 ATCAATACTTTAAAAAAGAAAGG + Intergenic
1067626270 10:47926623-47926645 ATCAATACTTTAAAAAAGAAAGG - Intergenic
1068036255 10:51763728-51763750 CTGGATAATTTAGAAAAAAAAGG + Intronic
1068331167 10:55571326-55571348 CTGCATAATTTATAAAGATAAGG - Intronic
1068527787 10:58150299-58150321 TTTCATATTTTAAAAAAATAGGG + Intergenic
1068761287 10:60712612-60712634 CTAAATACTTTAAACACAAAGGG + Intronic
1068846180 10:61677509-61677531 CTGCAGACTGGGAAAAAAAATGG - Intronic
1068881711 10:62056241-62056263 CTCCATAATTAAAAAATAAAAGG - Intronic
1068950500 10:62771892-62771914 CTGCATATTTTAATATAAATAGG - Intergenic
1068984398 10:63093944-63093966 CTGCACTCTTACAAAAAAAAAGG + Intergenic
1069408363 10:68126691-68126713 CTGGATACTTGAAAGAAAGATGG + Intronic
1069437883 10:68402121-68402143 CTACTTACTAAAAAAAAAAAAGG - Intronic
1069439429 10:68414486-68414508 CTGAATACTGAAAACAAAAAAGG + Exonic
1070690622 10:78522240-78522262 CTGTAGACTTTATAAACAAAAGG - Intergenic
1071042917 10:81336207-81336229 TTGCATAATTTATAAAGAAAAGG - Intergenic
1071124956 10:82323051-82323073 CTGCATAATTGAAATAAAATAGG + Intronic
1072359880 10:94649015-94649037 ATTCAAACTTTAAAAAAGAAGGG - Intergenic
1072459543 10:95606549-95606571 TTTCTTACTTTAAAAAAAAAGGG + Exonic
1072886669 10:99282880-99282902 ATGCCTACGTTAAAAAAAGAAGG + Intergenic
1073504112 10:103968402-103968424 CAGCATACTATAAAATAGAATGG + Intronic
1073983390 10:109180308-109180330 CTGTATACATTAAAAAAATAAGG - Intergenic
1074054902 10:109914488-109914510 CTTACTACCTTAAAAAAAAATGG + Intronic
1074227444 10:111499222-111499244 ATGCATACATTAATAAAAGATGG + Intergenic
1075010663 10:118867127-118867149 CTGAATTCCATAAAAAAAAAGGG - Intergenic
1075801624 10:125158585-125158607 CTCCAATCTTTAAAGAAAAAAGG + Intronic
1075907690 10:126095826-126095848 CTGGATAATTTATAAAGAAAGGG - Intronic
1076071509 10:127493596-127493618 CTGGGTACTTTATAAAGAAAAGG - Intergenic
1077114726 11:878579-878601 CTGAGTACTTTATAAAGAAAAGG - Intronic
1077971245 11:7193395-7193417 CTGAAAAATTGAAAAAAAAAAGG - Intergenic
1078086124 11:8233898-8233920 CTCCTGACTTTAGAAAAAAATGG + Intronic
1078298126 11:10096140-10096162 CTCCATACTTTAAAAATATTTGG + Intronic
1078312921 11:10264388-10264410 ATGCATGCTTGAAAAGAAAATGG + Intronic
1078547704 11:12258076-12258098 CTGCATCCTTTATAATAAATAGG - Intronic
1078657207 11:13252862-13252884 CTGAGTACTTTATAAAGAAAAGG + Intergenic
1078805799 11:14701581-14701603 CTACATAATTTAAAATAATATGG + Intronic
1079844221 11:25444093-25444115 CTGCATAATTTGTAAAGAAAAGG - Intergenic
1080116558 11:28627996-28628018 ATGCATAATTTAAGAAAACATGG + Intergenic
1080333555 11:31170679-31170701 CTACATACTGTAAAAGCAAATGG + Intronic
1080385499 11:31808638-31808660 CTACTGAATTTAAAAAAAAATGG - Intronic
1080853044 11:36088014-36088036 CAGCCAAATTTAAAAAAAAAAGG + Intronic
1081018430 11:37911771-37911793 CTGTATAATTTAAATAAATATGG + Intergenic
1081071029 11:38608564-38608586 CTGGATAATTTATAAAGAAAAGG + Intergenic
1081245899 11:40765434-40765456 CTGCATAATTTATAAAGAAAAGG - Intronic
1081453623 11:43198496-43198518 TTCCATATTTCAAAAAAAAATGG + Intergenic
1081662797 11:44898526-44898548 CTGGATAATTTATAAAGAAAAGG + Intronic
1082090680 11:48086910-48086932 ATGCATACTTTGATAGAAAATGG + Intronic
1082267108 11:50131089-50131111 GAGCTTACTTTAAAAAAATAAGG + Intergenic
1082288981 11:50347479-50347501 GAGCTTACTTTAAAAAAATAAGG - Intergenic
1082380629 11:51937251-51937273 TTGCATACTCTAGAAAAAGAGGG - Intergenic
1082499725 11:53660083-53660105 TTGCATACTCTAGAAAAAGAGGG - Intergenic
1082539442 11:54235007-54235029 TTGCATACTCTAGAAAAAGAGGG - Intergenic
1082683843 11:56213732-56213754 CTGCATATTTTTTAAAAAACTGG + Intergenic
1084130289 11:67128383-67128405 TTTCATACTAGAAAAAAAAAAGG - Intronic
1084213966 11:67637354-67637376 CTGCAAAAAGTAAAAAAAAATGG - Intronic
1084256299 11:67945227-67945249 TTGTAACCTTTAAAAAAAAATGG - Intergenic
1084913549 11:72410367-72410389 CTGCATCTGTTAAAAAAAAATGG + Intronic
1084994487 11:72962600-72962622 ATTCTTAGTTTAAAAAAAAAAGG - Intronic
1085136907 11:74099132-74099154 CATCATAATTTAAGAAAAAAAGG + Intronic
1085474734 11:76782850-76782872 TTTCACTCTTTAAAAAAAAATGG + Intronic
1085864366 11:80271409-80271431 CTGCATATTTGAAGAAGAAATGG - Intergenic
1085920351 11:80947933-80947955 GTTCATAGTTTTAAAAAAAATGG + Intergenic
1086352560 11:85957038-85957060 AAACATACTTAAAAAAAAAAAGG + Intergenic
1086639624 11:89137047-89137069 CTGCATACATTAGAAATGAACGG + Intergenic
1086764868 11:90683418-90683440 CTGAATAATTACAAAAAAAATGG - Intergenic
1086795795 11:91100397-91100419 GTTAATAATTTAAAAAAAAAAGG + Intergenic
1087039956 11:93788912-93788934 ATCCATCCCTTAAAAAAAAAGGG - Intronic
1087369883 11:97270161-97270183 CTGCAGAATTTCAAAGAAAAAGG + Intergenic
1087411548 11:97796644-97796666 TTGAATAGTTAAAAAAAAAAAGG + Intergenic
1087434242 11:98092573-98092595 TTTCATACTGTGAAAAAAAACGG + Intergenic
1087554527 11:99698680-99698702 CTGTATAAATTAAAACAAAATGG - Intronic
1087621250 11:100545306-100545328 CTGTATTTTTTTAAAAAAAAAGG + Intergenic
1087684406 11:101246836-101246858 CTGTTTTTTTTAAAAAAAAAAGG + Intergenic
1087694209 11:101356977-101356999 CTGGGTACTTTATAAAGAAAAGG - Intergenic
1087782302 11:102314079-102314101 TTGCACAATTAAAAAAAAAATGG - Intergenic
1088113574 11:106290858-106290880 TTCTATTCTTTAAAAAAAAATGG - Intergenic
1088317806 11:108525190-108525212 CTGGGTAATTTAAAGAAAAAGGG - Intronic
1088426063 11:109704791-109704813 CTGTATATTTAGAAAAAAAATGG - Intergenic
1088473076 11:110207618-110207640 CTGATTTGTTTAAAAAAAAAAGG - Intronic
1088698701 11:112392491-112392513 CTGCTTATTTAAAAATAAAATGG + Intergenic
1088763677 11:112956453-112956475 CTGCACAATTAAAAAAAAAAAGG + Intergenic
1089645846 11:119878236-119878258 GTACATACTTTGAAGAAAAATGG + Intergenic
1090067215 11:123513381-123513403 GTGCAACCTTAAAAAAAAAAAGG - Intergenic
1090297728 11:125604141-125604163 CTGCATCCTGTAAGAAAAAAAGG - Exonic
1090476763 11:127029354-127029376 CTACACACTTTAAAAATACATGG + Intergenic
1090602891 11:128390976-128390998 CGGTATACTTTAAACAAATAAGG - Intergenic
1091052870 11:132389544-132389566 AAGTATAATTTAAAAAAAAAAGG + Intergenic
1091067287 11:132527543-132527565 CTTCAAACTGAAAAAAAAAATGG - Intronic
1091196731 11:133737984-133738006 ATACATATTTTAAAAAAAGAGGG + Intergenic
1091430947 12:434152-434174 GCACATACTTTAAAAAAAAAAGG + Intronic
1091540572 12:1457615-1457637 CTGCTTAATGTATAAAAAAATGG - Intronic
1091598031 12:1892698-1892720 CTGAATGGTTTAAAAAAAAAGGG + Intronic
1092894111 12:12996641-12996663 TTGTATATTTAAAAAAAAAAAGG + Intronic
1093487140 12:19664500-19664522 CTGGATAATTTATAAAGAAAAGG - Intronic
1093759346 12:22889892-22889914 CTACGTACTTTAACAGAAAATGG + Intergenic
1094031422 12:26015868-26015890 GTGCATACTTTAAGAACACAAGG + Intronic
1095082414 12:38020576-38020598 TTGCATATTCTAAAAAAAAGAGG - Intergenic
1095111074 12:38295536-38295558 CTGGGTACTTTATAAAGAAAAGG + Intergenic
1095516762 12:43014965-43014987 CTGGGTACTTTATAAAGAAAAGG - Intergenic
1095636180 12:44436266-44436288 CTAGAAATTTTAAAAAAAAAAGG + Intergenic
1095688484 12:45062215-45062237 CTGGATAATTTATAAAGAAAAGG + Intergenic
1096249965 12:50024781-50024803 ATGCTTTCTTAAAAAAAAAAAGG + Intronic
1096370974 12:51068773-51068795 CTACCTTCTTGAAAAAAAAAGGG + Intronic
1098034956 12:66292497-66292519 CTGGATAATTTATAAAGAAAAGG + Intergenic
1098323047 12:69269169-69269191 ATGCATACTACAAAAATAAATGG - Intronic
1098332290 12:69366055-69366077 TTCCATACTTGAAAAAAAAAAGG - Intronic
1098476449 12:70909489-70909511 CATCAAACTTTACAAAAAAAAGG + Intronic
1098499158 12:71170483-71170505 TTGCATACTTCAAAATTAAAAGG - Intronic
1099272303 12:80525787-80525809 GTGGATACTATAAAAAACAATGG + Intronic
1099335465 12:81351325-81351347 TTGCATTCTTTAAATATAAAAGG - Intronic
1099934980 12:89115052-89115074 CTCCAAAAATTAAAAAAAAAAGG - Intergenic
1100080276 12:90840950-90840972 CTGCATATTTTTAAAAAATTGGG - Intergenic
1100170710 12:91971699-91971721 CTGAGTAATTTAAAAAGAAAAGG + Intergenic
1100397343 12:94196542-94196564 CTGGATAATTTATAAAGAAAAGG - Intronic
1100530388 12:95456540-95456562 CTGCAAACCTTGAAAAAGAAGGG - Intergenic
1100701028 12:97148487-97148509 CTGTATACTTTGAAAAAAATAGG + Intergenic
1100918710 12:99457162-99457184 CTGCATAAATGAAAAAAAGATGG + Intronic
1101349376 12:103914367-103914389 AATCATACTTTTAAAAAAAAAGG + Intergenic
1101373140 12:104148449-104148471 CTGCAGATTTTCAATAAAAATGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101540269 12:105658805-105658827 CCAAATACTTTAAAAAGAAATGG - Intergenic
1103189735 12:118991104-118991126 CTGTATACTTAAAAAAACATGGG - Intronic
1103352928 12:120298023-120298045 CTGCAGCCTTGAAAAAAAAAGGG + Intergenic
1103962607 12:124618330-124618352 TGGCATACTTAACAAAAAAAAGG - Intergenic
1104576331 12:129969602-129969624 CCTCAGACTTTAAAATAAAAAGG + Intergenic
1105733288 13:23242035-23242057 CTGAATATTTTAAAAAGAGAGGG + Intronic
1106139372 13:26998846-26998868 CTTCAAATTTTAAAAAATAACGG + Intergenic
1106464607 13:30001838-30001860 CTGGATAATTTATAAAGAAAAGG + Intergenic
1106795774 13:33203515-33203537 CTTCCTAATGTAAAAAAAAATGG - Intronic
1106887405 13:34203420-34203442 GTGCATACGTTTAAAATAAAAGG + Intergenic
1107072877 13:36290949-36290971 CTGCATACCTTGACCAAAAAAGG + Intronic
1107124958 13:36837014-36837036 ATGGATAGTTTAAAAAGAAAAGG - Intergenic
1107230108 13:38098787-38098809 CTGAATAATTTTAAAATAAAAGG + Intergenic
1107619592 13:42212616-42212638 CTGCAAAATTTAAAAACAGATGG - Intronic
1107926339 13:45266023-45266045 TTGCATATTTTAAGTAAAAAGGG + Intronic
1108404197 13:50083224-50083246 CTGTCTACCTTCAAAAAAAATGG + Intronic
1108740043 13:53327497-53327519 CTGCAAAAAATAAAAAAAAATGG - Intergenic
1108843696 13:54652395-54652417 CTCCTCACATTAAAAAAAAATGG - Intergenic
1108981414 13:56520645-56520667 CTGCACAATTTATAAAAGAAAGG - Intergenic
1109580743 13:64329868-64329890 CTAGACACATTAAAAAAAAATGG - Intergenic
1110383625 13:74882815-74882837 TTTCATACTTTAAAAGGAAAAGG - Intergenic
1110407747 13:75169477-75169499 CTGCATCGTTTAAAATATAACGG - Intergenic
1110487534 13:76064831-76064853 ATGCATAAATTAAAAATAAAAGG - Intergenic
1110893726 13:80722820-80722842 TTGCATTCATGAAAAAAAAATGG - Intergenic
1110917624 13:81042961-81042983 CTGCATTTTGAAAAAAAAAACGG - Intergenic
1110958584 13:81590477-81590499 CTGAGTGATTTAAAAAAAAAAGG + Intergenic
1111771719 13:92605172-92605194 TTGCCTAGTTTAAGAAAAAAGGG + Intronic
1111912381 13:94327149-94327171 ATGCATAATTTTAAAAATAAGGG + Intronic
1112532200 13:100216015-100216037 CTGCATATTTTAAAACACAGTGG - Intronic
1112579396 13:100665399-100665421 CTGATTAATTTAAACAAAAAGGG + Intronic
1112995724 13:105573112-105573134 CTGCACATTCTGAAAAAAAAAGG - Intergenic
1113325497 13:109277592-109277614 CCCCTTACTTTAAAGAAAAATGG - Intergenic
1113909003 13:113833013-113833035 TTTCATAATTTAAAAATAAAGGG - Intronic
1114154815 14:20088835-20088857 TTGCAGATTTTAAAAAAAGAAGG - Intergenic
1114697087 14:24635851-24635873 CTGCATTTTTTAAAATTAAAAGG + Intergenic
1114971973 14:28042391-28042413 AAGCATAATTAAAAAAAAAAAGG + Intergenic
1115047140 14:29009014-29009036 GTGCATAAATGAAAAAAAAATGG - Intergenic
1115205262 14:30896740-30896762 TTACATACTCTAAAAAAGAAAGG + Intronic
1115226339 14:31106157-31106179 CAGCAAACATTAAAAAAAAAAGG + Intronic
1115252921 14:31368349-31368371 CTGGATAATTTATTAAAAAACGG - Intronic
1115617050 14:35105487-35105509 CTTCAAACTTTAAAAAAAAAAGG - Intronic
1115809318 14:37089156-37089178 GTGCATAAATTAAAAAAGAATGG + Intronic
1115841023 14:37470459-37470481 ATACATACTTTAAAACAAACAGG - Intronic
1115889829 14:38013750-38013772 CTGCATGTTTTAAAAACTAAGGG + Intronic
1115983467 14:39079202-39079224 ATTCAAACATTAAAAAAAAATGG - Intronic
1116136825 14:40935337-40935359 ATGCATACTTTACAACAGAATGG + Intergenic
1116211285 14:41948263-41948285 CTGAAAACTATAAACAAAAATGG - Intergenic
1116278637 14:42871362-42871384 CTGTAAACAATAAAAAAAAAAGG + Intergenic
1116373886 14:44172579-44172601 CTGCAAAATTTAAAAATATACGG - Intergenic
1116438457 14:44921989-44922011 CTGCATGCATTAGAATAAAAAGG + Intergenic
1116649311 14:47568832-47568854 GTGCAAACTTAAAAAAAAATTGG - Intronic
1116812863 14:49556063-49556085 GAGGATAATTTAAAAAAAAATGG - Intergenic
1116912012 14:50477862-50477884 GTGCAAACATTAAAAATAAAAGG - Intronic
1117647964 14:57872337-57872359 CTGGGTACTAAAAAAAAAAAAGG - Intronic
1117989875 14:61422790-61422812 CTGCTTCTTTTAAAAAAAATGGG - Intronic
1118742660 14:68751607-68751629 ATACATTCTTAAAAAAAAAATGG - Intergenic
1118746503 14:68777297-68777319 CTGCGTGTTTTAAAAAAAACAGG - Intergenic
1118960451 14:70525185-70525207 ATACATACATTAAAATAAAATGG - Intronic
1119418165 14:74489293-74489315 CTGCATATGTTAAAAACATAAGG + Intronic
1119998101 14:79275307-79275329 CTTCATATTTGGAAAAAAAAAGG + Intronic
1120025132 14:79574942-79574964 ATTCTTGCTTTAAAAAAAAATGG + Intronic
1120343519 14:83253518-83253540 ATGATTTCTTTAAAAAAAAAAGG - Intergenic
1120400909 14:84030381-84030403 CTGCAAAGTTAAAAAAAAAAAGG - Intergenic
1120824163 14:88940253-88940275 CTGGATACTTTAGTAAATAAAGG - Intergenic
1121092548 14:91192858-91192880 CTGCATTCTTTTAAAAATTATGG - Intronic
1121710714 14:96037837-96037859 CGGCATACTTCACAATAAAAGGG - Intergenic
1121779045 14:96609970-96609992 CTGCATTTGTTAAACAAAAATGG - Intergenic
1121900124 14:97686322-97686344 CTGGGTAATTTAAAAAGAAAAGG + Intergenic
1122001326 14:98657218-98657240 CTTCAAAATTAAAAAAAAAAAGG - Intergenic
1122967071 14:105136336-105136358 CTGCATATAAAAAAAAAAAATGG - Intergenic
1124326140 15:28764321-28764343 CTTTGTGCTTTAAAAAAAAAAGG + Intergenic
1124448387 15:29761108-29761130 CTGTATTTTTTAAAAAAATAGGG + Intronic
1125071197 15:35555441-35555463 CTGCAATTTTTAAAAAGAAATGG + Intergenic
1125444065 15:39734147-39734169 CTACATGCTTCAAGAAAAAAAGG + Intronic
1125696726 15:41644165-41644187 CTTCATACTTTATATAAAACTGG + Intronic
1125865347 15:43042341-43042363 ATTCAGCCTTTAAAAAAAAAGGG + Intronic
1126056731 15:44736720-44736742 CTGCTAAGTTAAAAAAAAAAAGG - Intronic
1126252890 15:46589051-46589073 CTGGTTAATTTAAAAAGAAAAGG + Intergenic
1126661809 15:51039790-51039812 ATGCAGACTTTAACACAAAATGG - Intergenic
1127182966 15:56443160-56443182 ATACATACTTTAAAAGCAAAAGG - Intronic
1127245681 15:57171230-57171252 ATGAATTCTTAAAAAAAAAAAGG - Intronic
1127613267 15:60657709-60657731 AGGCATACTTCAAGAAAAAAAGG + Intronic
1129173540 15:73822647-73822669 CTGCATCATTTAGAAAGAAAAGG + Intergenic
1129950194 15:79579794-79579816 CTGCATAATTTCTAGAAAAATGG - Intergenic
1130369848 15:83275882-83275904 TTTCATACATAAAAAAAAAAAGG - Intronic
1130520992 15:84660490-84660512 CAGCCTACTATAGAAAAAAAAGG + Intergenic
1130751340 15:86716289-86716311 ATGCTAACTTAAAAAAAAAAAGG - Intronic
1130923912 15:88371112-88371134 CTGCGTAATTTATAAAGAAAAGG - Intergenic
1131237558 15:90710302-90710324 GTTTATACTTAAAAAAAAAAAGG - Intergenic
1131383881 15:91986468-91986490 CTGCATACTTTAAAAAAAAATGG - Intronic
1131412759 15:92224407-92224429 CTGGATAATTTATAAAGAAAAGG + Intergenic
1131527664 15:93165644-93165666 CTTAATACTTTAAGACAAAAAGG + Intergenic
1131588615 15:93722856-93722878 CTGCTCAGTTTAAAGAAAAAAGG - Intergenic
1132024568 15:98394084-98394106 CTTCCTCCTTTAAAAAGAAATGG + Intergenic
1133433735 16:5761442-5761464 CTGGATACTTTATAAAGGAAAGG + Intergenic
1133544683 16:6794375-6794397 CTACACTCTTTGAAAAAAAATGG + Intronic
1133644065 16:7746440-7746462 CTGCATACTTTTTAAAAAAAAGG - Intergenic
1133955166 16:10436390-10436412 ATGTATTATTTAAAAAAAAAAGG - Intronic
1134742329 16:16559078-16559100 ATGCATGCATTAAAAAAATATGG - Intergenic
1134925236 16:18153381-18153403 ATGCATGCATTAAAAAAATATGG + Intergenic
1135209566 16:20512859-20512881 CTGGATACTCTAAAAAGAAGAGG - Intergenic
1135375176 16:21940261-21940283 CTCCATACTTGGAAAACAAAAGG - Intergenic
1135714869 16:24754554-24754576 TTCCATACTTTAAAAAAAGGAGG + Intronic
1136262129 16:29085568-29085590 CTGTCTTCTTTAAAAAAAAAAGG + Intergenic
1136636232 16:31525215-31525237 CCCCATCTTTTAAAAAAAAAAGG - Intergenic
1137079977 16:36036774-36036796 TTGCAGATTTTACAAAAAAAGGG - Intergenic
1137227946 16:46532886-46532908 CTGGATAATTTATAAAGAAAGGG - Intergenic
1138816350 16:60207286-60207308 CTGCACACATTAAATAATAAAGG + Intergenic
1139452981 16:67046902-67046924 GTGCATACTTTCATAAAAAAAGG - Intronic
1139811745 16:69624747-69624769 CTGAGTACTTTAAAATACAAAGG - Intronic
1140333460 16:74080847-74080869 ATGCATAATTTAAAAAAGGATGG - Intergenic
1140844362 16:78872401-78872423 CTCCCTTCTTTAAAAAAAGATGG - Intronic
1140962750 16:79932225-79932247 CTGGAAAATTTAAAAAAAAAAGG + Intergenic
1142584125 17:960083-960105 CTCCATCTTTAAAAAAAAAATGG + Intronic
1143038977 17:4018426-4018448 CTGTTAAATTTAAAAAAAAAAGG - Intronic
1144333256 17:14244070-14244092 ATGCATACATTAAACAAAGAAGG - Intergenic
1144576057 17:16430173-16430195 CTGTATACTTTAAAAAAAAAAGG - Intronic
1147273611 17:39295754-39295776 TTGCATATTTTCAAAAAGAATGG - Intronic
1147519137 17:41152085-41152107 TTGCATACTGTAAGAAATAAGGG + Intergenic
1148249562 17:46064257-46064279 CTGCATACTAGAATAAAACAAGG + Intronic
1148399565 17:47343934-47343956 CTGCATACTTAAGAAAACCATGG + Intronic
1148509243 17:48154736-48154758 CAGGATGCTTTTAAAAAAAATGG + Intronic
1148527809 17:48358354-48358376 CTTTACACTTTAAAAAAAAGAGG - Intronic
1148653686 17:49267796-49267818 CTGCCTAATTTTAAAAACAATGG + Intergenic
1148883079 17:50747027-50747049 CTGCAGTGTGTAAAAAAAAAAGG - Intronic
1149158040 17:53657255-53657277 CTACATTCATTAAAGAAAAAAGG + Intergenic
1149427700 17:56570608-56570630 CTACAGACTTCAAAAAAAATGGG + Intergenic
1150320373 17:64208597-64208619 ATGCTTGCTTTAAAAAAAATAGG - Intronic
1150685801 17:67319929-67319951 ATGCATATTTTAAAACCAAAAGG - Intergenic
1151085925 17:71380493-71380515 CTGCCCCCTTTAAGAAAAAAAGG - Intergenic
1151525912 17:74667589-74667611 CTCCAAAGTTTAAAAATAAAGGG + Intergenic
1151871069 17:76837154-76837176 ATACATACTATACAAAAAAATGG + Intergenic
1152490221 17:80626404-80626426 ATGTACACTTAAAAAAAAAATGG + Intronic
1152686817 17:81697998-81698020 CTGGCTAATTAAAAAAAAAAGGG + Intronic
1153185073 18:2477413-2477435 CTGCATAATTTATAAAGAAAAGG + Intergenic
1153538011 18:6123608-6123630 CTGGATAATTTATAAAGAAAAGG - Intronic
1153666781 18:7373464-7373486 TTGCATATTTTGAAATAAAATGG - Intergenic
1153795759 18:8620558-8620580 CTGATTAGTTAAAAAAAAAAAGG - Intronic
1153986770 18:10357664-10357686 CTGGATAATTTATAAAGAAAAGG - Intergenic
1154004804 18:10517960-10517982 CTGTATACTAGAAAGAAAAATGG - Intergenic
1154244502 18:12683745-12683767 CTGTCTCATTTAAAAAAAAAAGG + Intronic
1154408276 18:14117606-14117628 CTGGGTATTTTAAAAAAAAGAGG + Intronic
1154408618 18:14121341-14121363 ATACTTACTATAAAAAAAAAAGG + Intronic
1154934747 18:21041503-21041525 CTGCATTTTTGAAAGAAAAATGG - Intronic
1155476313 18:26238589-26238611 AAGTATAATTTAAAAAAAAAAGG - Intronic
1155816983 18:30324448-30324470 CTACATACTTTTAAAAAACCAGG + Intergenic
1156171911 18:34494868-34494890 CTGATTTCTTTAAAAAATAATGG + Intronic
1156766088 18:40657246-40657268 CAGCTTCCTTTAAAAAAAATTGG - Intergenic
1156779216 18:40830665-40830687 CCACATATTTTAGAAAAAAAAGG + Intergenic
1157456974 18:47840593-47840615 CAACATACTTTAAAAACAGATGG + Exonic
1157969181 18:52246659-52246681 CAGCATATTTGAAATAAAAATGG - Intergenic
1157973285 18:52295749-52295771 CTTGATAATTTAAAAAAAACAGG + Intergenic
1157997170 18:52572351-52572373 CAGAGTAGTTTAAAAAAAAATGG - Intronic
1158216359 18:55104389-55104411 CTGGATAATTTATAAAGAAAAGG + Intergenic
1158248915 18:55464723-55464745 ATGTCTAGTTTAAAAAAAAAAGG - Intronic
1158842796 18:61406174-61406196 CTTCATACTTGAACAAAAATGGG - Intronic
1159264858 18:66067667-66067689 CTGGATCCTTTAAAAAAATAAGG + Intergenic
1159409256 18:68049856-68049878 CTGCCTAGTTAAAAATAAAAAGG + Intergenic
1159811709 18:73024959-73024981 CTGAGTAATTTAAAAAAAAAGGG - Intergenic
1159862669 18:73667595-73667617 CTGCATACATTAAGAAAATGAGG + Intergenic
1160125796 18:76170181-76170203 CTGGATACTTTTCAAAGAAAGGG + Intergenic
1160376001 18:78412429-78412451 CTGTAAACTTTTAGAAAAAATGG - Intergenic
1161500737 19:4613942-4613964 CTTCAAACTGTAAAAAAAATTGG + Intergenic
1161806012 19:6443396-6443418 CTTCATTTTTTAAAAAAAGATGG + Intronic
1162418002 19:10549723-10549745 CTGCATAGTATAAAAAAAGAAGG - Intronic
1162438680 19:10679499-10679521 CTGCAAGCTGAAAAAAAAAAGGG - Intronic
1162471579 19:10875331-10875353 CATCTCACTTTAAAAAAAAAAGG - Intronic
1162962966 19:14138886-14138908 CTGGATTGTTTAAAAAGAAAAGG - Intergenic
1163239185 19:16048975-16048997 TTGCATCCTTAAAAAAAAAAGGG + Intergenic
1164337277 19:24339662-24339684 CTGCAGATTTTACAAAAACAGGG - Intergenic
1164355526 19:27423302-27423324 CTGCATAATCTACAAAAAGACGG - Intergenic
1164491920 19:28722854-28722876 TTGCATGCTTTAAAAAAATCAGG - Intergenic
1164712307 19:30365921-30365943 CTTCATTTTTTAAAAAAAATAGG + Intronic
1165288982 19:34867902-34867924 CTGGGTACTTTACAAAGAAAAGG + Intergenic
1166220047 19:41358313-41358335 CTGGATAATTTATAAAGAAAAGG + Intronic
1166478269 19:43147944-43147966 CTGGATAATTTATAAAGAAAAGG - Intronic
1167358686 19:49018698-49018720 CTGGGTGCTTAAAAAAAAAAGGG + Intergenic
1168031766 19:53685548-53685570 CAGCACACATTAAAAAAAATTGG - Intergenic
1168367448 19:55800785-55800807 CTGCAGCCTTTTACAAAAAAGGG + Intronic
1168649198 19:58082447-58082469 TAGAAAACTTTAAAAAAAAAAGG + Intronic
925153533 2:1633838-1633860 CTGCTTTATTTAAAAAGAAATGG + Exonic
925742576 2:7018881-7018903 ATTCATGCTTAAAAAAAAAAAGG + Intronic
925820991 2:7799671-7799693 CTGCTTACTTTAAAAGGGAAAGG + Intergenic
926520931 2:13912110-13912132 CTGGATAATTTATTAAAAAAAGG - Intergenic
927443293 2:23135258-23135280 CTGCATGCTTTAAAAATACATGG - Intergenic
927904399 2:26846957-26846979 CAGGATACTTTCAAACAAAATGG - Intergenic
928281489 2:29950257-29950279 CTGCAAAGTGTAACAAAAAAAGG - Intergenic
928495881 2:31831268-31831290 CAGCAGACTTAAAAAAAAATGGG - Intergenic
928703596 2:33923842-33923864 CTGAATACTTAAAAAAAAAATGG + Intergenic
928993011 2:37255701-37255723 ATGAATACTTAAGAAAAAAATGG + Intronic
929020649 2:37549128-37549150 ATGCATAGTTAAAAAAATAAAGG - Intergenic
929108695 2:38388335-38388357 CTGCATATTTTCAGAAAACAGGG + Intergenic
929208268 2:39322967-39322989 ATGCATACTCTTAAAAATAAGGG - Intronic
930259120 2:49124549-49124571 CTGAACAATTGAAAAAAAAATGG - Intronic
930326266 2:49922719-49922741 CTGTATTCTTTAAAATACAAGGG - Intronic
930796708 2:55400211-55400233 ATACATTCTTTAGAAAAAAATGG - Intronic
930948831 2:57111525-57111547 CTGCATAATTTATAAAGAAAAGG - Intergenic
931022636 2:58066720-58066742 AGGCATTCTTTTAAAAAAAATGG + Intronic
931029788 2:58160180-58160202 CTGCAAATTTTAAAAGATAAAGG + Intronic
931118546 2:59191231-59191253 GTTCATACTTTAGAAATAAAGGG + Intergenic
931312735 2:61097591-61097613 CTGCATATTTCATATAAAAATGG + Intronic
931552430 2:63461520-63461542 CTGGATAGTTTATAAAGAAAAGG - Intronic
932062566 2:68522098-68522120 CTATAAACTTTAAATAAAAATGG + Intronic
932202398 2:69842785-69842807 CTTCTTAATTTAAAAAGAAATGG + Intronic
932538210 2:72621918-72621940 CAGCATACTTCAAAAAAATGAGG + Intronic
933044020 2:77510885-77510907 CTGCAGGTTTTAAAATAAAATGG - Intronic
933405432 2:81851828-81851850 CTACATACTTTTAAAAAACCAGG + Intergenic
933650761 2:84848184-84848206 ATGCATACTGTTAGAAAAAAAGG - Intronic
934101139 2:88654068-88654090 ATTCTTACATTAAAAAAAAAAGG - Intergenic
934515971 2:94986891-94986913 TTGCTTATTTAAAAAAAAAAAGG + Intergenic
934666914 2:96178289-96178311 CTGAAAACTTTAAAAAAAACAGG + Intergenic
935637731 2:105262512-105262534 CTGGATAGTTTATAAAGAAAAGG - Intergenic
936544834 2:113382104-113382126 CTGGAAACTGAAAAAAAAAAAGG + Intergenic
936907112 2:117549530-117549552 CAGTTTACTTTAAAAAAAACAGG - Intergenic
937488476 2:122340608-122340630 CTGAATACTTTGTAAAGAAAAGG - Intergenic
937628590 2:124072270-124072292 CTGAATAATGGAAAAAAAAATGG + Intronic
937709720 2:124965676-124965698 TTGCATAATTTAGAAATAAATGG + Intergenic
937799587 2:126066303-126066325 ATGCATAGTTTCAAAATAAATGG + Intergenic
937960988 2:127458670-127458692 CTCCATCTCTTAAAAAAAAAAGG + Intronic
939453210 2:142399673-142399695 CTGGATAATTTATAAAGAAAAGG - Intergenic
939489865 2:142864336-142864358 ATGGCTTCTTTAAAAAAAAAAGG + Intergenic
939878652 2:147605501-147605523 CAGCATACATTAATAAGAAAAGG - Intergenic
940042607 2:149376329-149376351 CTGAATACTATTAAAATAAATGG + Intronic
940314329 2:152311503-152311525 CTTCATAATTTAAAAAACATTGG - Intergenic
941037359 2:160582875-160582897 CTGTGTTCTTAAAAAAAAAAAGG + Intergenic
941165969 2:162083355-162083377 CTTCAGATTTAAAAAAAAAAAGG + Intergenic
941484012 2:166056153-166056175 CTGTAGATTTTAAAGAAAAAGGG + Intronic
941551568 2:166922359-166922381 CTTCATAATTTTAAAAGAAATGG - Intronic
941646187 2:168044111-168044133 CTGCCTACTTCATGAAAAAAAGG - Intronic
941768084 2:169320351-169320373 CTACATCCTTTACATAAAAATGG + Intronic
942103823 2:172613461-172613483 CTCCATCTCTTAAAAAAAAAAGG - Intergenic
942378747 2:175364782-175364804 CTGCAAACTTTAATGATAAAAGG - Intergenic
942438766 2:176009434-176009456 TTGCTGACTTTGAAAAAAAATGG + Intergenic
942521158 2:176805764-176805786 CTACTTGATTTAAAAAAAAATGG - Intergenic
942590277 2:177536960-177536982 CTGAATACTTTAATGAAAGAAGG + Intronic
943059465 2:183025338-183025360 TTACATACCTTAAAAAGAAACGG + Intronic
943626077 2:190201277-190201299 CTTAATCCTTTAAAACAAAAAGG - Exonic
943690723 2:190867028-190867050 TTGCATCATTTAAAAATAAAAGG - Intergenic
943715419 2:191146750-191146772 CTGCCTCCCTAAAAAAAAAAAGG + Exonic
944032348 2:195250753-195250775 CTGCCTAATTTAAGCAAAAAGGG - Intergenic
944587754 2:201187427-201187449 AGGCATATTTAAAAAAAAAAAGG - Intronic
945058299 2:205887038-205887060 CTGAATCCTTTAGAATAAAATGG + Intergenic
945070307 2:205982616-205982638 CAGCATACTTGGAAAAAAATTGG + Intergenic
946087281 2:217186729-217186751 CTGCATCCTTTAGTAAAACAGGG - Intergenic
946114265 2:217447815-217447837 CTGCATTCTACAAAGAAAAATGG + Intronic
946126453 2:217567215-217567237 ATGCAACCTTTAAAATAAAAGGG + Intronic
946630601 2:221663774-221663796 CTCCATAATATAAAAATAAATGG + Intergenic
946917533 2:224540395-224540417 CTTTATATTTAAAAAAAAAAGGG + Intronic
947095813 2:226565388-226565410 CAGGATGCTTTAGAAAAAAAAGG - Intergenic
948119111 2:235515654-235515676 CTGCAGCCTTTAAAAGAGAATGG + Intronic
948125210 2:235559740-235559762 AAGCATATTTAAAAAAAAAAAGG - Intronic
948182897 2:235996829-235996851 CTGCATACTTTTTAAAAATTGGG + Intronic
948997285 2:241588658-241588680 CTGCATACTTTAATAAATTAAGG + Intronic
1169175699 20:3511138-3511160 ATGCATACATTAAAAAAGAAAGG + Intronic
1169331852 20:4722578-4722600 CTCCTTATATTAAAAAAAAAAGG - Intronic
1169454348 20:5738946-5738968 CAGCATACTTTTCAGAAAAACGG - Intergenic
1169763074 20:9118081-9118103 CTACAAACATTAAAAGAAAAAGG + Intronic
1169864163 20:10182334-10182356 CAGAATACATGAAAAAAAAATGG + Intergenic
1170340846 20:15325426-15325448 AGGCAAACTTTAAAATAAAAAGG - Intronic
1171324444 20:24278793-24278815 CTAAAAACTTAAAAAAAAAAAGG - Intergenic
1171782190 20:29429217-29429239 ATGAATCCTCTAAAAAAAAATGG + Intergenic
1172040590 20:32041917-32041939 CTGGCTACTTTACAAATAAAAGG + Intergenic
1172667577 20:36611290-36611312 GAGTATAATTTAAAAAAAAATGG - Intronic
1172881740 20:38204662-38204684 TTGCACACTTAAAAACAAAATGG - Intergenic
1173163110 20:40666828-40666850 ATGGCTACTTTAAAAAAAATGGG - Intergenic
1173786196 20:45794506-45794528 GGGCAGATTTTAAAAAAAAAAGG - Intronic
1173969480 20:47140765-47140787 CTGGATAATTTATAAAGAAAAGG + Intronic
1174701999 20:52618453-52618475 ATGCTTTCTTTAAAAACAAAAGG + Intergenic
1176957112 21:15118451-15118473 CGGAATAGTTTAACAAAAAATGG + Intergenic
1177297860 21:19200528-19200550 CTTCATTTTTTAAAAAAAACAGG + Intergenic
1177320184 21:19511037-19511059 CTGCTTAGTTAAGAAAAAAATGG - Intergenic
1177400688 21:20600933-20600955 ATACATAATTTAAAAACAAATGG + Intergenic
1177827900 21:26104299-26104321 ATACATACTTGAAAAAAAAGGGG + Intronic
1177949119 21:27511493-27511515 GTGTATTCTTCAAAAAAAAAGGG - Intergenic
1178165755 21:29974480-29974502 CTGAATAAATTAAAAACAAATGG + Intergenic
1178825036 21:36007602-36007624 CTCAAAACTTAAAAAAAAAAGGG + Intergenic
1178906023 21:36637498-36637520 CACCATACATTAAAAGAAAAAGG - Intergenic
1179223512 21:39430894-39430916 TTGCATTTTTTAAAGAAAAAAGG - Intronic
1179277485 21:39905746-39905768 TTGCATAGTTTAAAAAAATGTGG + Intronic
1179357445 21:40673719-40673741 CTGCATACTTTTAAACAACCAGG - Intronic
1179511088 21:41874150-41874172 TTGCTTAATTTAAAAAAAAAAGG + Intronic
1179831663 21:44000774-44000796 CTGCATCCTTTAAATAAATGTGG - Intergenic
1180686327 22:17669911-17669933 CTGGATAGTTTATAAAGAAAAGG - Intronic
1180736331 22:18020572-18020594 ATGTATACTTTCAAATAAAATGG + Intronic
1181895880 22:26106988-26107010 CTGGATAATTTATAAAGAAAAGG + Intergenic
1183193852 22:36339700-36339722 CTGCAAAGTTTAAAGAAAAAAGG + Intronic
1183669349 22:39263326-39263348 CTGGATGCTTTATAAAGAAAAGG + Intergenic
1183914936 22:41110126-41110148 CTCAATAACTTAAAAAAAAAGGG - Intronic
1183918584 22:41144888-41144910 CTGGCTGCTTTAAAAAAAAAAGG + Intronic
1184268529 22:43363988-43364010 CTGCTCACTTAAAAAAAAAAGGG + Intergenic
1184704592 22:46201924-46201946 CTGCCTGCCTTAAAAAAGAAAGG - Intronic
1184708130 22:46229643-46229665 CTCCAAACTTTAACAAACAATGG + Intronic
949511990 3:4774428-4774450 ATGCTTACTGTAAAAAAAATGGG - Intronic
949599031 3:5578833-5578855 ATTAAGACTTTAAAAAAAAATGG - Intergenic
949969129 3:9387699-9387721 ATGCATATTTTTAAAAAAATAGG + Intergenic
951534354 3:23727889-23727911 CTGCCTACATTAAACAAAAAGGG - Intergenic
951560000 3:23956578-23956600 CTACATACTTGAAAAAAATGTGG + Intronic
951574166 3:24096701-24096723 ATGAATACTTCAAAAAAAACAGG - Intergenic
951899478 3:27642689-27642711 GGGTATAGTTTAAAAAAAAAAGG + Intergenic
952676249 3:36033978-36034000 ATGCATAGTTTAAAAAGAAGAGG + Intergenic
952859983 3:37805066-37805088 CCCCATACTTAAAAAAAAAAAGG - Intronic
953058890 3:39410570-39410592 CTGCATACATTAAAAAAGACAGG - Intronic
953735010 3:45486143-45486165 CTACCAGCTTTAAAAAAAAAAGG + Intronic
953948747 3:47171326-47171348 CTGTCTCTTTTAAAAAAAAAAGG + Intergenic
954479022 3:50780352-50780374 CTGTATAATTTATAAAGAAAAGG + Intronic
955520883 3:59774332-59774354 CTGCATACTTTCTCTAAAAAGGG - Intronic
955792866 3:62606568-62606590 CTGGATAATTTATAAAGAAAAGG - Intronic
956586982 3:70875380-70875402 CTGGGTACTTTATAAAGAAAAGG - Intergenic
957083297 3:75657178-75657200 ATGAATCCTCTAAAAAAAAAGGG - Intergenic
957222642 3:77403541-77403563 ATTCAGACTTTAAAAAACAAGGG - Intronic
957226158 3:77450330-77450352 ATGCATATTTTAGAGAAAAAGGG + Intronic
957294192 3:78315213-78315235 TGCCATCCTTTAAAAAAAAATGG + Intergenic
957542544 3:81592403-81592425 TTGCATGCATGAAAAAAAAATGG - Intronic
957629459 3:82700807-82700829 CTCCAGCCTTTAAAAAAAGAAGG - Intergenic
957836040 3:85590828-85590850 CTTCACACTATAAACAAAAAAGG + Intronic
958002154 3:87763520-87763542 CAGCATACTATAGAAAAAAAAGG - Intergenic
958141467 3:89568010-89568032 GTGCATACATCAAAAAAAAAAGG + Intergenic
958212344 3:90502418-90502440 TTGCAGACTTTACAAAGAAAGGG + Intergenic
958493228 3:94805568-94805590 TTGCATATTTTAAACAAACATGG + Intergenic
958784918 3:98587400-98587422 CTGCATAATTTATAAATAAAAGG + Intronic
959086304 3:101853831-101853853 CTGCATCCTTTGAAAGAAACTGG - Exonic
959105093 3:102056835-102056857 CTGGATAATTTATAAAGAAAAGG + Intergenic
959147121 3:102561396-102561418 TTGAATACTTCAAAAAAAAGAGG - Intergenic
959220961 3:103519023-103519045 CTTTATAAATTAAAAAAAAAAGG + Intergenic
959238854 3:103761947-103761969 ATGCATATTTTAAAATAAGAAGG - Intergenic
959372796 3:105549634-105549656 CAGAAAACTTTAGAAAAAAATGG + Intronic
959389240 3:105753366-105753388 CTGTTTTTTTTAAAAAAAAAAGG + Intronic
959537900 3:107507883-107507905 CTGCATAATTTCACAAAAAAAGG + Intergenic
959772152 3:110111140-110111162 CTGCATGCCTTAAAAAAGCAAGG + Intergenic
959777914 3:110191240-110191262 CAACATACTTTATATAAAAACGG - Intergenic
959954497 3:112219966-112219988 GTGCATATTTTAAAGAAGAAAGG - Intronic
960330007 3:116347562-116347584 CTAAATATTTTAAAAGAAAATGG - Intronic
960406656 3:117269289-117269311 TTGCATACATTAAAAAATTAAGG - Intergenic
961342690 3:126239168-126239190 CTGGGTAATTTACAAAAAAAAGG + Intergenic
961973901 3:131001834-131001856 CTGCTTACATTACAAGAAAAAGG - Intronic
962137292 3:132748585-132748607 CTGCATACATGACATAAAAATGG + Intergenic
963398200 3:144760101-144760123 CTTCTTACTATGAAAAAAAAAGG - Intergenic
963470914 3:145740663-145740685 CTGAATAATTTAAAGAAAAGAGG - Intergenic
963768944 3:149368943-149368965 TTGCAAACTGGAAAAAAAAAAGG + Intergenic
964082211 3:152773265-152773287 CTCAAAAATTTAAAAAAAAAAGG - Intergenic
964857875 3:161166592-161166614 GTGCAAAGTTTAAAAATAAAAGG + Intronic
964929406 3:161998278-161998300 CTTCATCCATTAAAAAAAATTGG + Intergenic
965217800 3:165886092-165886114 CTGCTTACTTGAAAAAAGCATGG + Intergenic
965252993 3:166367073-166367095 CTTAATACTTTAATTAAAAAAGG + Intergenic
965339644 3:167472448-167472470 CTGCAAAGTTTGAAACAAAATGG + Intronic
965956344 3:174375116-174375138 CTGTATCCTTTTAAAATAAAGGG - Intergenic
966391414 3:179456587-179456609 CTGCACACTAAAAGAAAAAAAGG - Intergenic
966655790 3:182357641-182357663 TTGCTTACTATAGAAAAAAAGGG - Intergenic
967127075 3:186434054-186434076 ATGCATCCTTTAAAAACAAAAGG + Intergenic
967164523 3:186768642-186768664 CTCTATATTTAAAAAAAAAATGG - Intergenic
967418555 3:189247282-189247304 ATGGATATTTTAAAAGAAAAAGG - Intronic
968015346 3:195326983-195327005 CTGCAGACTTAAAAAAAGTATGG + Intronic
969196542 4:5567706-5567728 ACCCATAATTTAAAAAAAAATGG + Intronic
969402617 4:6966295-6966317 ATGCATTCATTAAAAACAAATGG - Intronic
970121409 4:12757202-12757224 CTTCAAAATTTAAAAAAAAATGG - Intergenic
970229579 4:13895176-13895198 CTACCCAATTTAAAAAAAAAGGG - Intergenic
970478589 4:16450515-16450537 CTGCATATTAAAAAAACAAATGG - Intergenic
970501725 4:16684322-16684344 TTGCACACATTAAAAACAAAAGG - Intronic
970553706 4:17210176-17210198 CTTCATTTTTTTAAAAAAAAGGG - Intergenic
971189591 4:24414674-24414696 CTGCATACTTGAAACACAAGGGG - Intergenic
971530630 4:27684136-27684158 AGGCATACTTAAGAAAAAAATGG + Intergenic
971582881 4:28365402-28365424 CAGAATAGATTAAAAAAAAATGG + Intronic
971619174 4:28831741-28831763 CTGCATACTATAGAAAACAATGG - Intergenic
971751675 4:30657471-30657493 CTTTATACTTTTAAATAAAAAGG - Intergenic
971847872 4:31944311-31944333 CTGAATACTTTATAAATAATTGG - Intergenic
971996941 4:33976802-33976824 CAGCATAAATTAAAAAGAAAAGG + Intergenic
972383635 4:38542504-38542526 CTCCATACATGAAAAAACAAAGG - Intergenic
972483149 4:39517175-39517197 GTAACTACTTTAAAAAAAAATGG - Intronic
972729387 4:41778601-41778623 TTGAATAATTTAAAAAGAAATGG + Intergenic
972880415 4:43416408-43416430 CTGGATAATTTATAAAGAAAAGG + Intergenic
973002835 4:44973135-44973157 CTGCAAAGTTTAAAAGTAAAAGG - Intergenic
973221771 4:47734442-47734464 CTGAATATTTTAAAAGAGAAAGG - Intronic
974008020 4:56579466-56579488 ATGCCTATATTAAAAAAAAAAGG + Intronic
974094253 4:57345130-57345152 TTGCACACTTCAGAAAAAAAAGG + Intergenic
974252710 4:59408828-59408850 CTGCATAATTTAAACAAAAGAGG + Intergenic
974405121 4:61457379-61457401 TTTCATACATTAAGAAAAAATGG + Intronic
974508835 4:62810427-62810449 CTCCATTCATTAACAAAAAATGG + Intergenic
975495697 4:75033970-75033992 CAGCTTACTCTTAAAAAAAAGGG + Intronic
975566601 4:75762493-75762515 AGAAATACTTTAAAAAAAAAAGG - Intronic
975641243 4:76502246-76502268 CTGCCTAATTTATAAAGAAAAGG - Intronic
975647476 4:76559482-76559504 CTCTATACTTTAAAAAAGACTGG + Intronic
976306984 4:83569828-83569850 CTGCCTCAGTTAAAAAAAAAAGG + Intronic
976409819 4:84700507-84700529 TAGCATACTTTAAAAAACAGTGG - Intronic
976446363 4:85134486-85134508 CTACATACTATAAAAACATAGGG + Intergenic
977101636 4:92823308-92823330 CTGTATATTTTAAATATAAAAGG - Intronic
977236824 4:94517743-94517765 CTGCATATTTTCAACAAATATGG - Intronic
977333043 4:95662153-95662175 CTCCCTACTTTCAAAAGAAAAGG + Intergenic
977378479 4:96238485-96238507 CTGACTAATTTAAAAAGAAAAGG - Intergenic
977460491 4:97319409-97319431 CTGGATAATTTATAAAGAAAAGG - Intronic
977470791 4:97438755-97438777 CTGGATAATTTATAAAGAAAAGG - Intronic
977654771 4:99508076-99508098 TTGCTTACTTTAAAAAAGCAAGG - Intergenic
977853718 4:101861415-101861437 TTCCATACTTAAAAAAAACAGGG - Intronic
978285133 4:107068748-107068770 GTGCCTCCTTTAAAAATAAATGG + Intronic
978740120 4:112127519-112127541 CTTCCCACTTTAAAAAAAAAAGG + Intergenic
979248260 4:118534643-118534665 ATGCATTATTTAAGAAAAAACGG - Intergenic
979464495 4:121021281-121021303 CTGCATAATTTGCAAAAGAAAGG + Intergenic
979722105 4:123912536-123912558 CTGCTTACTTTAATAAAAACAGG - Intergenic
980018952 4:127685141-127685163 CAGCATACTTTTATTAAAAAGGG - Intronic
980075973 4:128293233-128293255 GTGAATATTTTAAAATAAAAAGG + Intergenic
980180866 4:129399134-129399156 CTCAAAACTTTAAAAAAAGAAGG - Intergenic
980187711 4:129482561-129482583 ATATATATTTTAAAAAAAAAAGG - Intergenic
980732295 4:136838467-136838489 CTGCATAATTTATAAAGAAAGGG - Intergenic
980888318 4:138786804-138786826 CTGCATGTTTTCAAATAAAAAGG + Intergenic
981425339 4:144596188-144596210 ATGAATTCTTTAAAAACAAAGGG - Intergenic
981440996 4:144781730-144781752 CTGCATGCTTGAAAACATAATGG + Intergenic
981643541 4:146972838-146972860 CTGCATGCTTTAGAATAAACTGG - Intergenic
981879760 4:149595324-149595346 CTTCCTACTTAAAAAATAAAGGG - Intergenic
982086194 4:151839155-151839177 CTACATACTTTAAAAAATGATGG + Intergenic
982376662 4:154698141-154698163 CAGTATACTTTTAAAATAAATGG + Intronic
982580177 4:157167732-157167754 CTGTATAATTTATAAGAAAATGG + Intronic
982732304 4:158969389-158969411 GCACATTCTTTAAAAAAAAATGG - Intronic
982813571 4:159856998-159857020 ATGGGTACTTTAAAAAGAAAAGG + Intergenic
983098352 4:163593348-163593370 CTGCATACATTGAAGTAAAAAGG + Intronic
983791812 4:171808549-171808571 CTTAATAGTTTAAAAAACAAGGG - Intergenic
984507960 4:180643056-180643078 ATTCACACTTAAAAAAAAAAAGG + Intergenic
985175584 4:187196308-187196330 CTGCATACTTTACACAAATGGGG - Intergenic
985215826 4:187652558-187652580 CTTGATACTTTGAAGAAAAACGG - Intergenic
985266399 4:188155505-188155527 ATACATACATTAAAAAACAAAGG - Intergenic
985314048 4:188635476-188635498 TTGCAAAATTAAAAAAAAAATGG - Intergenic
985854573 5:2414952-2414974 CTCCCTACTTTATAGAAAAAAGG + Intergenic
986932178 5:12839394-12839416 CTGCATATTTTAGGAAAAAGGGG - Intergenic
987199724 5:15563895-15563917 CTAAATATTTCAAAAAAAAATGG + Intronic
987240269 5:15990287-15990309 ATGCCTACATTTAAAAAAAAAGG - Intergenic
987635723 5:20538334-20538356 CTGGATGCTTCAAAAATAAATGG + Intronic
987697084 5:21345571-21345593 AAGCATACTTCAAAATAAAAAGG - Intergenic
988040797 5:25887208-25887230 CTGGATGATTTAAAAAGAAAAGG + Intergenic
988105284 5:26739003-26739025 CTGCATACTTGAAAAGTAACAGG - Intergenic
988312658 5:29581214-29581236 CTAAATACTGTAAAATAAAATGG - Intergenic
988320894 5:29695342-29695364 TTGTATACAATAAAAAAAAAAGG - Intergenic
988443868 5:31263093-31263115 CTGGATAATTTATAAAGAAAAGG + Intronic
988548942 5:32183028-32183050 CTGGGTAATTTATAAAAAAAAGG - Intergenic
989246025 5:39255692-39255714 CTGTATACTTTAAAGCCAAAGGG + Intronic
989258064 5:39387718-39387740 CTTTATAAATTAAAAAAAAATGG - Intronic
989446271 5:41533241-41533263 CTGCATTTTTTAATAAACAAGGG + Intergenic
990000551 5:50886645-50886667 ATGCATTCTTTAACAAAAGAGGG + Intergenic
990180107 5:53151358-53151380 CTGGGTAATTTACAAAAAAAAGG - Intergenic
990581172 5:57168928-57168950 CAGCATACTATTAAGAAAAATGG - Intergenic
990659285 5:57995242-57995264 CTGCAGACTTGTAAGAAAAATGG + Intergenic
990697253 5:58433950-58433972 CTGCAGACTTCAAAAATAAGTGG + Intergenic
990834821 5:60005824-60005846 CTGCACCCTTTTAAAAAAACTGG - Intronic
990998095 5:61753535-61753557 CTTCATCATTTAATAAAAAATGG + Intergenic
991584720 5:68190272-68190294 AAGCATATTTCAAAAAAAAAAGG + Intronic
992002711 5:72451325-72451347 CTTCAAAATTTAATAAAAAATGG + Intronic
992040952 5:72831735-72831757 CTTCATAGTTATAAAAAAAATGG - Intronic
992252387 5:74888365-74888387 CTGGGTGCTTAAAAAAAAAAAGG + Intergenic
992821212 5:80498323-80498345 CTGCAGAATTTAAAAAAAAAAGG - Intronic
992924285 5:81565736-81565758 GTAGATACTTTAAAAGAAAACGG + Intronic
992939428 5:81749656-81749678 TTGCACAGTTTAAAAAAAAAAGG + Intronic
992993801 5:82312996-82313018 CTTCATACCTTAAAAGACAAAGG - Intronic
993076423 5:83237697-83237719 CTGTATATTTCAAAATAAAAGGG + Intronic
993274388 5:85837840-85837862 ATGCATACTTGAGAAAAAACAGG - Intergenic
994117535 5:96077831-96077853 CTGGATAATTTATAAAGAAAAGG - Intergenic
994652163 5:102542570-102542592 CTGCATACCTGAAACAAATAGGG + Intergenic
994930476 5:106176567-106176589 CTGCCTTTTTTGAAAAAAAATGG - Intergenic
994956078 5:106534735-106534757 ATGCTTACTTTAAATATAAATGG - Intergenic
995073510 5:107953090-107953112 TTTCATACTTTAAAAAAAAAAGG + Intronic
995625111 5:114067950-114067972 ATGTTTACTTTAAAATAAAATGG + Intergenic
995962749 5:117863344-117863366 CTGGATTCTTTAATGAAAAAAGG - Intergenic
996051737 5:118942507-118942529 TTGAAAACATTAAAAAAAAAAGG + Intronic
996131659 5:119788819-119788841 ATGCCTTCTTTAAAAAAAATTGG - Intergenic
996148750 5:120009325-120009347 TTGCACACTTTTAGAAAAAAAGG - Intergenic
997755604 5:136396242-136396264 CCTTATACTTTAAAAAAAGATGG + Intronic
997901233 5:137766938-137766960 CTTAAAACATTAAAAAAAAATGG - Intergenic
998090844 5:139367478-139367500 TTGCATCAGTTAAAAAAAAAGGG - Exonic
998125687 5:139619555-139619577 CTGGATAATTTATAAAGAAAAGG + Intronic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
998581416 5:143380397-143380419 ATAAAGACTTTAAAAAAAAATGG - Intronic
998725901 5:145014396-145014418 TTTCATAACTTAAAAAAAAAGGG - Intergenic
998748572 5:145291036-145291058 ATCATTACTTTAAAAAAAAAGGG + Intergenic
999161033 5:149499286-149499308 CTTTATTCCTTAAAAAAAAAGGG + Intronic
999662669 5:153882048-153882070 CTGAAGGCTTTCAAAAAAAAAGG + Intergenic
999872789 5:155769987-155770009 TTGCATAGTAGAAAAAAAAATGG - Intergenic
1000706393 5:164518366-164518388 CTGCATTATTTAAAAAAGAATGG - Intergenic
1000739946 5:164956363-164956385 CAACATACTTTAAATAAACAAGG + Intergenic
1001172526 5:169433936-169433958 ATGCATATTTTACAGAAAAATGG + Intergenic
1001284439 5:170412233-170412255 CTGCATGACCTAAAAAAAAATGG - Intronic
1001891877 5:175346111-175346133 AAGTATAATTTAAAAAAAAAAGG + Intergenic
1002486414 5:179540632-179540654 CTGAAAAGTTTAAAAATAAAAGG + Intergenic
1002564944 5:180106395-180106417 ATGCATACATTAGAAAAAAGGGG - Intronic
1002906658 6:1454596-1454618 CTTCTAAATTTAAAAAAAAAAGG + Intergenic
1003326647 6:5097050-5097072 CTGGATAATTTATAAAGAAAGGG + Intergenic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1003863530 6:10343393-10343415 CTGAATGATTTAAAAAGAAAAGG + Intergenic
1003894265 6:10591936-10591958 ATGCATACTTTGAAAAAGACTGG - Intronic
1004217245 6:13714121-13714143 AGGGATACCTTAAAAAAAAATGG - Intergenic
1004281906 6:14287149-14287171 CTGTATCCTTTATAATAAAATGG - Intergenic
1004392416 6:15220849-15220871 CTCCCCACTCTAAAAAAAAAAGG + Intergenic
1004648149 6:17582494-17582516 CTGCTTGGTTAAAAAAAAAAAGG - Intergenic
1004825682 6:19418146-19418168 CTGTACACTTTAACAAAAATTGG - Intergenic
1005622184 6:27630393-27630415 CTCCATACTTTTAAAAAAAAGGG - Intergenic
1005651114 6:27885831-27885853 ATTCATACTGTAAAAGAAAAGGG - Intergenic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1006958049 6:37894386-37894408 CAACAGACTTAAAAAAAAAAAGG - Intronic
1007510417 6:42370581-42370603 CTACATAGTTTAAAAAGCAAAGG + Intronic
1007538128 6:42613827-42613849 ATGCAAAATTAAAAAAAAAATGG - Intronic
1007649767 6:43412129-43412151 CAGCCTAATTAAAAAAAAAAAGG + Intergenic
1008162617 6:48097191-48097213 AAGCATAATTTAAAAAATAATGG + Intergenic
1008294848 6:49762814-49762836 CCACATGCTTTAGAAAAAAAAGG - Intergenic
1008603058 6:53114365-53114387 CTGCCTGGTTTAAGAAAAAAGGG + Intergenic
1009253695 6:61347116-61347138 TTGCAGACTCTAAAAAAAGACGG - Intergenic
1009258381 6:61448937-61448959 TTGCAGACTCTAAAAAAAGACGG - Intergenic
1009535801 6:64882474-64882496 CTGCCTACATTAACAGAAAAAGG + Intronic
1009589741 6:65652029-65652051 CTACATACATCAGAAAAAAATGG - Intronic
1009604945 6:65856200-65856222 CTGCATACTATAAAAATGTAAGG - Intergenic
1009635030 6:66253988-66254010 CTGGGTAATTTAAAAAAGAAAGG + Intergenic
1009829404 6:68911409-68911431 AAGTATAATTTAAAAAAAAAAGG + Intronic
1009909954 6:69913743-69913765 ATTCATATTTTAAAAAAAAGTGG + Intronic
1010288618 6:74109390-74109412 CAGGATACTTTACAAAAATATGG - Intergenic
1010431016 6:75778751-75778773 TTAAATACTTAAAAAAAAAATGG + Intronic
1010545163 6:77145372-77145394 ATGCATTTTTTAAAAAGAAAAGG + Intergenic
1010557918 6:77307658-77307680 ATGTATACTTTAAAAGCAAAGGG - Intergenic
1010756595 6:79672417-79672439 AAGCCCACTTTAAAAAAAAATGG - Intronic
1010773330 6:79857781-79857803 CTGAAGACTCTGAAAAAAAAAGG + Intergenic
1011050545 6:83143780-83143802 CTGCAGAATTTAAAAACAAGAGG + Intronic
1011186968 6:84688282-84688304 CTGCATACTCTGAAAAGACAGGG + Intronic
1011817074 6:91205225-91205247 ATACATACTTTAAAAAAAATTGG + Intergenic
1011926112 6:92646665-92646687 CTGCCTACTTGAACAAAAATGGG - Intergenic
1012104989 6:95145906-95145928 CTGGTTACTTCAAAAAAAAAGGG + Intergenic
1012524259 6:100158233-100158255 ATGCATATTGTAAAAAAAAATGG + Intergenic
1012662370 6:101917585-101917607 ATCCAAACTTAAAAAAAAAAAGG - Intronic
1012824935 6:104135508-104135530 CCAGATACATTAAAAAAAAAAGG - Intergenic
1014081306 6:117289175-117289197 GTACATACTTTAGACAAAAAGGG - Intronic
1014227426 6:118863858-118863880 CTGGGTAGTTTATAAAAAAAAGG - Intronic
1014623425 6:123697542-123697564 CTTCATACTCCAACAAAAAAGGG + Intergenic
1014777727 6:125529612-125529634 ATGCAGAGGTTAAAAAAAAATGG + Intergenic
1014948819 6:127530157-127530179 CTGGATAATTTATAAAAAAAAGG + Intronic
1015308405 6:131736301-131736323 CTGGATAATTTATAAAGAAAAGG + Intronic
1015330406 6:131972031-131972053 CTGAATACAATAAAAATAAATGG + Intergenic
1015331379 6:131983436-131983458 CTGGGTAATTTAAAAAGAAAAGG + Intergenic
1015500294 6:133924864-133924886 CTGCATAATGTCTAAAAAAAGGG + Intergenic
1015529066 6:134202798-134202820 GTGCATTTTTTAAAAAATAAGGG - Intronic
1016190226 6:141255757-141255779 GGGTACACTTTAAAAAAAAAAGG + Intergenic
1016478482 6:144455171-144455193 TTGCATAATTTCAAAATAAATGG - Intronic
1016493044 6:144628403-144628425 CTGCACACATTTCAAAAAAAAGG - Intronic
1017158578 6:151343928-151343950 ATACATGCTTTAAAAAATAATGG + Intronic
1017232540 6:152088766-152088788 CTGGATAATTTACAAAGAAAAGG - Intronic
1017480535 6:154849962-154849984 CTGCACACTGTAAGAAACAACGG - Intronic
1017569148 6:155724379-155724401 CAGAATACTTTAAAAAATATCGG + Intergenic
1018514580 6:164564513-164564535 CTGTATTCTTGAAAAAAACATGG + Intergenic
1019511100 7:1417815-1417837 CTAAATATTTTAAAATAAAAAGG + Intergenic
1020456767 7:8382370-8382392 CTGCATAATTTATAGGAAAATGG + Intergenic
1020692980 7:11381069-11381091 TTGAATAGTTTAAAAAAGAATGG + Intronic
1020886725 7:13827377-13827399 CTCCGTACTTAAAAAAAAAATGG - Intergenic
1020977147 7:15020792-15020814 CATAATACTTAAAAAAAAAAAGG - Intergenic
1021409699 7:20316033-20316055 CTGGATACTTTATAAACAACGGG - Intergenic
1021833050 7:24637331-24637353 CTGCATACATTATATCAAAAAGG - Intronic
1021919554 7:25470777-25470799 CTGCAAAGTTAAAAAAAAAAGGG + Intergenic
1021926769 7:25541365-25541387 GTTCAAACATTAAAAAAAAATGG + Intergenic
1022147852 7:27564381-27564403 CTACATATATTAAGAAAAAAAGG - Intronic
1022416673 7:30184128-30184150 CTGCATAGTTGAAATAAAAGTGG + Intergenic
1022751848 7:33236462-33236484 ATACATACTTTAAACAAAATGGG + Intronic
1022944261 7:35266387-35266409 CAGCATAATTTAAAAAAGACTGG + Intergenic
1023526778 7:41112339-41112361 CTGCAAAATTTAAAAATACATGG + Intergenic
1023680602 7:42683239-42683261 CTATGTACTTGAAAAAAAAATGG + Intergenic
1023757943 7:43437253-43437275 CTGCCTTCGTTAAAAAGAAAGGG - Intronic
1024107259 7:46105177-46105199 TTGCCCAGTTTAAAAAAAAATGG - Intergenic
1024711520 7:52020182-52020204 CTGCACAGTTTACAAAAAATGGG - Intergenic
1024811203 7:53214446-53214468 AAGCTTATTTTAAAAAAAAATGG + Intergenic
1024864634 7:53891087-53891109 CTGCACATTTTACTAAAAAATGG + Intergenic
1026044050 7:66893349-66893371 AGACATCCTTTAAAAAAAAAAGG - Intergenic
1026358999 7:69585543-69585565 CTGCGTAATTTATAAAGAAAAGG - Intergenic
1026392451 7:69915354-69915376 CTGCTTATTTTTAAAAATAAAGG + Intronic
1027460568 7:78447798-78447820 CTGCATATTTCAAAAAAGAAAGG - Intronic
1027503959 7:78991246-78991268 CTGAATAATTTATAAAAGAAAGG - Intronic
1027613400 7:80390899-80390921 ATGCATAATTTTAAAAAAATAGG + Intronic
1027656272 7:80934524-80934546 ATGCATATCTTAAAAAAAACAGG + Intergenic
1027832032 7:83189682-83189704 CTGCATATTTTAATAAACAAAGG + Intergenic
1027898889 7:84082585-84082607 TTCCTTACTTTAAAAAGAAAAGG + Intronic
1028045214 7:86108783-86108805 CTGGATAATTTATAAAGAAAAGG - Intergenic
1028165609 7:87534943-87534965 CTGCACAGTGGAAAAAAAAATGG - Intronic
1028252254 7:88550922-88550944 CTCTGTACTTAAAAAAAAAAAGG - Intergenic
1028522258 7:91744484-91744506 ATTCTTACTTTAAAAAAATATGG - Intronic
1028733152 7:94176499-94176521 TTCCATAAATTAAAAAAAAATGG + Intergenic
1029378555 7:100197599-100197621 CTTCTTACTTAAAAAACAAAAGG - Intronic
1030609793 7:111676928-111676950 CTGATTGCTTTAAAAGAAAATGG - Intergenic
1031368893 7:120939271-120939293 CTGGATAAGTTAAAAAATAACGG - Intergenic
1031395694 7:121271323-121271345 CTGGATACTGCAAAAAAACATGG + Exonic
1031421293 7:121554707-121554729 CTCCATACTTTAAAAATGATTGG - Intergenic
1031445483 7:121848305-121848327 CTGAAGACTTCAAAAAATAATGG - Intergenic
1031722792 7:125197833-125197855 CTGCAGTCTTTAAAAATATAAGG + Intergenic
1031839915 7:126725667-126725689 CTGGGTAATTTAAAAAGAAAAGG + Intronic
1031929903 7:127674345-127674367 CTGTATATATTAAAAAACAAGGG + Intronic
1032163458 7:129527634-129527656 CTCCATACTTTACAACAAAATGG + Intergenic
1032232382 7:130086116-130086138 CTGCTTACTTTAAAAAGTAAGGG - Intronic
1032335818 7:131023383-131023405 CTGGATAATTTATAAAGAAAAGG - Intergenic
1032758813 7:134918258-134918280 CTGGATGTTTTAAAAGAAAATGG + Intronic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1033100658 7:138468270-138468292 ATTCATACATTAACAAAAAAAGG - Intronic
1033123989 7:138691182-138691204 CGGCAGACTTTAAAACCAAAAGG + Intronic
1033132464 7:138756550-138756572 CAGAATAAGTTAAAAAAAAAGGG + Intronic
1033215185 7:139488156-139488178 GTGCATACTGTAGAAAAGAAAGG + Intergenic
1033286688 7:140047521-140047543 CTGGATAATTTATAAAGAAAAGG - Intronic
1033461318 7:141550036-141550058 GTGAATGCTTCAAAAAAAAAAGG - Intergenic
1033477257 7:141702488-141702510 CAGCGGACTTTAAAAAATAATGG - Intergenic
1033858666 7:145597508-145597530 ATACATACTTTAAAAAATACAGG - Intergenic
1033922207 7:146408264-146408286 CAGAATACTTTAATAAAAATAGG + Intronic
1033963357 7:146942556-146942578 TTGCATAAATTAAAATAAAAAGG + Intronic
1034007524 7:147490762-147490784 CTGGATAATTTAGAAAGAAAAGG + Intronic
1034821513 7:154220709-154220731 CTGGGTACTTTAGAAAAAACAGG - Intronic
1035358230 7:158292397-158292419 CCTCATACTTTAAAATTAAAAGG + Intronic
1036455255 8:8901204-8901226 CTGCATTTTTTGAAAAAAGATGG + Intergenic
1036976057 8:13413836-13413858 CTGCGTAATTTATAAAGAAAGGG - Intronic
1037083371 8:14815410-14815432 CTACTTACTTCAAAACAAAAGGG + Intronic
1037298669 8:17428214-17428236 CTGCACAATTTACAAAAGAAAGG - Intergenic
1038069991 8:24003318-24003340 CTTCATTCTATAAAAAACAAAGG + Intergenic
1038103956 8:24412629-24412651 CTTCATCATTTAAAAAAAAAAGG + Intergenic
1038306501 8:26407965-26407987 ATTCAAACTTTAAGAAAAAAAGG - Intronic
1038391168 8:27202693-27202715 CTGGAGAGTTTAAAAAAATATGG + Intergenic
1039449785 8:37663209-37663231 CTGAATAATTTATAAAGAAAGGG + Intergenic
1040395097 8:46991159-46991181 CTGCTTTCTTTGAAAAAACAAGG - Intergenic
1040404719 8:47088549-47088571 ATAAATAATTTAAAAAAAAAAGG + Intergenic
1040444695 8:47481855-47481877 CTGAATATTTTAAGAACAAAGGG - Intronic
1040456718 8:47605537-47605559 ATGCATATTTAAAAGAAAAATGG - Intronic
1040461425 8:47652789-47652811 ATGCATACTTCACAAAAAACAGG + Intronic
1040504440 8:48034573-48034595 GTGTATAAGTTAAAAAAAAAGGG - Intronic
1040698802 8:50036006-50036028 CTGCAAAATTAAAAAAAAATTGG + Intronic
1041308948 8:56494560-56494582 CTGAATTGTTTTAAAAAAAATGG + Intergenic
1041468119 8:58178324-58178346 CTGCAGACTTTGGAAAAAATAGG + Intronic
1041488473 8:58405529-58405551 CTGGATAATTTATAAAGAAAAGG - Intergenic
1041548774 8:59077327-59077349 CTGCATACTTAGAGAAGAAAGGG - Intronic
1041651327 8:60306279-60306301 CTGCATATTTTAAATAAGAAGGG - Intergenic
1041702640 8:60808331-60808353 TTCCCAACTTTAAAAAAAAATGG - Intronic
1042181320 8:66090494-66090516 CTCCCTCCTTTAAAAAAAATTGG - Intronic
1042596900 8:70459285-70459307 CTGGATAATTTATAAAAAAAAGG + Intergenic
1043093154 8:75929754-75929776 TTGAATACTTTCAGAAAAAAAGG - Intergenic
1043095088 8:75958333-75958355 CTGCATACCTTTAACAAAATAGG - Intergenic
1043115343 8:76245449-76245471 CTGCACACTGTGAAAAAATATGG + Intergenic
1043424712 8:80137026-80137048 CTGCCTACTTTAAAAAAAATTGG - Intronic
1043495823 8:80798828-80798850 CTGAATAATTTATAAAGAAAAGG + Intronic
1043622338 8:82210732-82210754 CTTCTTCCTTAAAAAAAAAAAGG + Intergenic
1043893742 8:85720100-85720122 AAGTATAATTTAAAAAAAAATGG + Intergenic
1043896422 8:85741549-85741571 AAGTATAATTTAAAAAAAAATGG + Intergenic
1043900192 8:85770820-85770842 AAGTATAATTTAAAAAAAAATGG - Intergenic
1043902154 8:85786095-85786117 AAGTATAATTTAAAAAAAAATGG - Intergenic
1043903763 8:85798288-85798310 AAGTATAATTTAAAAAAAAATGG - Intergenic
1043905375 8:85810482-85810504 AAGTATAATTTAAAAAAAAATGG - Intergenic
1043906984 8:85822669-85822691 AAGTATAATTTAAAAAAAAATGG - Intergenic
1043963444 8:86444921-86444943 CTGGATAATTTATAAAGAAAAGG + Intronic
1044028093 8:87198836-87198858 CTGGATAATTTATAAAGAAAAGG + Intronic
1044129823 8:88507939-88507961 CTTAATAAATTAAAAAAAAATGG + Intergenic
1044299825 8:90570602-90570624 CACCAAACTTTAAAAACAAAAGG + Intergenic
1044466312 8:92510848-92510870 CTTCAAACTTAAAAAAAAATAGG - Intergenic
1044490779 8:92811776-92811798 CTTCATTCTTTAAAACATAATGG - Intergenic
1044826967 8:96207963-96207985 CAAAGTACTTTAAAAAAAAATGG + Intergenic
1045037239 8:98185157-98185179 CTACATACCTTTAAAAAATAAGG + Intergenic
1045100774 8:98841808-98841830 CTGCAGACTATAAGAAAAATAGG + Intronic
1045168732 8:99639431-99639453 CTGCATAGTTTGAAAGAATATGG + Intronic
1045772168 8:105755718-105755740 CTGCCTTTTTTAAAAAAACAAGG + Intronic
1045922795 8:107551897-107551919 ATGATTACATTAAAAAAAAATGG - Intergenic
1046036777 8:108852439-108852461 AAGCATACTTTTAAAATAAAGGG + Intergenic
1046082787 8:109392500-109392522 CTGTTGGCTTTAAAAAAAAATGG - Intronic
1046199068 8:110898273-110898295 TGGCATACTTTGAAAAAAAAAGG - Intergenic
1046325571 8:112640417-112640439 CTCCATTGTTTTAAAAAAAAGGG + Intronic
1046391853 8:113584322-113584344 TTGATTTCTTTAAAAAAAAATGG - Intergenic
1046431005 8:114127614-114127636 ATTCATACTTTTAAAAATAATGG + Intergenic
1046511701 8:115212116-115212138 CTGGATAATTTATAAAGAAAAGG - Intergenic
1046611366 8:116429325-116429347 CTGGGTAATTTATAAAAAAAAGG + Intergenic
1047095227 8:121617881-121617903 CTTAATACTTTAGAATAAAAAGG - Intronic
1047440983 8:124878537-124878559 CTGGCTAGTTTAAACAAAAAAGG + Intergenic
1048107315 8:131425771-131425793 CTGTATAATCTAAAACAAAAAGG - Intergenic
1048247580 8:132825395-132825417 CTTCAAATTTTAAAAAAAGAGGG - Intronic
1049917976 9:336873-336895 CTGGGTAATTTAAAAAGAAAAGG + Intronic
1050059879 9:1696265-1696287 CTGCAGGGTTTAAAAAAACATGG - Intergenic
1050096465 9:2072696-2072718 CTGCCTGATTTAAATAAAAAGGG + Intronic
1050125770 9:2354986-2355008 CTGCAGACTTTAAACACACAGGG + Intergenic
1050282063 9:4060750-4060772 CTGGATAATTTAACAAGAAAAGG - Intronic
1050430262 9:5554997-5555019 GTGCAAACAGTAAAAAAAAATGG + Intronic
1050936013 9:11396036-11396058 TACCATAATTTAAAAAAAAAGGG - Intergenic
1050955717 9:11656577-11656599 CTGCACAATGTAAATAAAAATGG - Intergenic
1051070281 9:13157866-13157888 CTGTATACATTAAAAAATGATGG + Intronic
1051083668 9:13322543-13322565 TTAAACACTTTAAAAAAAAAAGG - Intergenic
1051560914 9:18439017-18439039 ATGGATACTTTGAAAATAAAAGG - Intergenic
1051758558 9:20434394-20434416 CTTTATAATTTAAAAAAAATTGG - Intronic
1051818646 9:21138792-21138814 TTCCATAATTTAAATAAAAAAGG + Intergenic
1051825438 9:21213379-21213401 TTGCATCCTTTAAAAAGACAGGG + Intronic
1051868783 9:21713124-21713146 CTGCATTCTGTAAAACAAACGGG - Intergenic
1052163939 9:25298518-25298540 CTTTATAAGTTAAAAAAAAAAGG - Intergenic
1052266078 9:26575263-26575285 CTGCATACACCAAAAATAAATGG + Intergenic
1052385662 9:27821051-27821073 CACCATACTTTATAACAAAATGG - Intergenic
1052719678 9:32158395-32158417 CTGCTTACTATTGAAAAAAATGG - Intergenic
1055118538 9:72632030-72632052 CTGGATAATTTATAAAGAAAAGG + Intronic
1055209498 9:73773052-73773074 CTAAATACTTAAAAAAATAAAGG + Intergenic
1055241075 9:74187131-74187153 CGGCATATTTTAAAATAAAATGG + Intergenic
1055372294 9:75613101-75613123 CTGCCAACTTCAAAAATAAATGG - Intergenic
1055541994 9:77319236-77319258 CTATATCCTTAAAAAAAAAAGGG - Intronic
1055982044 9:82013746-82013768 ATTCATACTTTAAAAAATAATGG - Intergenic
1056048510 9:82744188-82744210 CAACATACTTGAAAAAAATAAGG - Intergenic
1056397552 9:86195541-86195563 CAGCACAGTTTAGAAAAAAAAGG + Intergenic
1056978772 9:91287084-91287106 CTTAATCCTTTAAAAAAAATGGG + Intronic
1057404740 9:94758921-94758943 CTTCTCACTTGAAAAAAAAAAGG - Intronic
1057922872 9:99112831-99112853 CAGCAAAGATTAAAAAAAAATGG + Intronic
1058336495 9:103836165-103836187 CTACCTACTTACAAAAAAAAAGG + Intergenic
1058474747 9:105320906-105320928 TTGCATATTTTAAAACAAACTGG + Intronic
1058808247 9:108613948-108613970 CTTTATTCTTTAAAAGAAAAAGG + Intergenic
1058883199 9:109303172-109303194 CTCCATACTTAGAAAAAAAGAGG + Intronic
1058924522 9:109649521-109649543 CTCCATACATTCAAAAAAATTGG - Intronic
1059645339 9:116260734-116260756 TTTCATAGTTAAAAAAAAAATGG + Intronic
1060059072 9:120443075-120443097 CTTCATAATTTTAAAAAGAAAGG + Intronic
1060960223 9:127675531-127675553 CAGCCTACTTTAAAACAAGATGG + Intronic
1061677246 9:132224623-132224645 TTGCATATTTTAATAAAAATAGG + Intronic
1062164262 9:135098907-135098929 ATGCATAGTTTGAATAAAAAAGG + Intronic
1062604176 9:137336724-137336746 ATGCATATTTTAAGAAAACAAGG + Intronic
1203752013 Un_GL000218v1:88758-88780 ACGCAATCTTTAAAAAAAAATGG + Intergenic
1203538228 Un_KI270743v1:62713-62735 CTGCATAGTATAGAAAACAATGG - Intergenic
1185666458 X:1769041-1769063 CAGAAGACTTTTAAAAAAAAGGG - Intergenic
1185925839 X:4144916-4144938 ATGTATATTTTGAAAAAAAAAGG + Intergenic
1186047792 X:5554690-5554712 GTGCATACTCTGAAAATAAAAGG - Intergenic
1186107359 X:6222032-6222054 TTGGATCCTTTAAAAAAGAAAGG - Intronic
1186276932 X:7949278-7949300 CTGGGTAATTTAAAAAGAAAAGG - Intergenic
1186353680 X:8767620-8767642 CTTGATACTCTAAAACAAAATGG + Intergenic
1186526598 X:10254858-10254880 GTTCACACTTGAAAAAAAAAAGG - Intergenic
1186602992 X:11058374-11058396 CTGAATAATTTATAAGAAAAAGG + Intergenic
1186984268 X:14994798-14994820 GTTAATAGTTTAAAAAAAAAGGG - Intergenic
1187116579 X:16358455-16358477 ATACATAAATTAAAAAAAAAAGG - Intergenic
1187219995 X:17315579-17315601 CAGCACAATTTAAAAATAAACGG + Intergenic
1187242381 X:17525163-17525185 TTAAATACTTTACAAAAAAATGG + Intronic
1187935495 X:24331880-24331902 CTGCATCCTTTATAACAAACTGG + Intergenic
1188616088 X:32160893-32160915 CTGCATAGGTTAGCAAAAAATGG - Intronic
1188619648 X:32204647-32204669 CTGGGTGCTTTAAAAAGAAAAGG + Intronic
1188640077 X:32490160-32490182 TTGCATACTGTAAAAAAGAATGG - Intronic
1188918826 X:35946466-35946488 CTCCATTCTGTAAGAAAAAAAGG - Intronic
1189059770 X:37740165-37740187 CCGCCTACATTAAAAAATAAGGG + Intronic
1189270547 X:39748511-39748533 GTCCTTATTTTAAAAAAAAAGGG + Intergenic
1189458324 X:41214466-41214488 AAGTATAATTTAAAAAAAAAAGG + Intronic
1189660692 X:43294940-43294962 TTGGTTACTGTAAAAAAAAATGG - Intergenic
1189872175 X:45395433-45395455 AAGCATATTTTAAAAAATAATGG - Intergenic
1192365560 X:70469750-70469772 GTTCATATTTTAAAAAGAAATGG - Intronic
1192426895 X:71084975-71084997 TCCCATCCTTTAAAAAAAAATGG - Intergenic
1192434337 X:71133652-71133674 CTGCATACTTTCAGAGAACAAGG - Intronic
1192833083 X:74770940-74770962 TTGCATATGTTAAAAAATAAAGG + Intronic
1192862639 X:75093665-75093687 CTGCATTCTGGAGAAAAAAAGGG + Intronic
1193581505 X:83269400-83269422 GGGCATATATTAAAAAAAAAAGG + Intergenic
1193837797 X:86367006-86367028 CTGCATCTTTAAAAAAAATATGG - Intronic
1194951391 X:100130701-100130723 CTGCTTTTTTTAAAAAAACAAGG + Intergenic
1195549507 X:106151126-106151148 CTGGATAATTTATAAAGAAAAGG - Intergenic
1195609065 X:106843724-106843746 CTGCAAACAAGAAAAAAAAAAGG + Intronic
1195694170 X:107654670-107654692 CTGCCAACTATAAAAAATAAGGG + Intergenic
1195758300 X:108220805-108220827 CTGCATATTTTAATAAGAGATGG - Intronic
1196046230 X:111259228-111259250 ATGCATAATTTAAAATAAATAGG + Intronic
1196401517 X:115321962-115321984 CTGCATGCTTTAAGCAGAAAGGG - Intergenic
1196831384 X:119778320-119778342 TTACATATTTTAAATAAAAAAGG - Intergenic
1196881617 X:120204165-120204187 CTGCATAATTTATAAAGAAAAGG + Intergenic
1196986262 X:121275671-121275693 CTACATACTTTAAAAGACACAGG - Intergenic
1197333803 X:125186710-125186732 CTGCAGGCTTTAAAGAAACATGG - Intergenic
1197336513 X:125215611-125215633 ATGGATACTTAAAAAAAATATGG - Intergenic
1197721378 X:129747088-129747110 CTTCTGAGTTTAAAAAAAAAAGG + Intronic
1197890674 X:131267219-131267241 CTGTATATTTTAAAATAACAGGG + Intergenic
1198090176 X:133321035-133321057 CTGCCTCTTTTAAAAAAGAAAGG + Intronic
1198160908 X:134007277-134007299 CCCCATAATATAAAAAAAAAGGG - Intergenic
1198173734 X:134133937-134133959 TTTCATAATTTAAAAAAATATGG + Intergenic
1198240058 X:134776390-134776412 CAGCATACTATATAAAATAAAGG - Intronic
1198477359 X:137008596-137008618 AAGTATAATTTAAAAAAAAAAGG + Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198844695 X:140898440-140898462 CTGGTTGCTTAAAAAAAAAAGGG - Intergenic
1199311301 X:146323800-146323822 GTACAATCTTTAAAAAAAAATGG + Intergenic
1199379232 X:147148166-147148188 CTGCACACTGTAAAGAAAATAGG - Intergenic
1199507962 X:148587465-148587487 TTGCATAATTGAAAAAAGAAAGG + Intronic
1200753653 Y:6969810-6969832 CTGTGGATTTTAAAAAAAAAAGG + Intronic
1200840869 Y:7780521-7780543 TTGCTAAGTTTAAAAAAAAAAGG + Intergenic
1200969688 Y:9137839-9137861 CTGAACACATTAAATAAAAAGGG + Intergenic
1200983902 Y:9286609-9286631 GTGCATACTGTAAAGAAATAGGG - Intergenic
1201711906 Y:17001740-17001762 TTCCATTCTTTAAAATAAAAAGG + Intergenic
1201978155 Y:19875519-19875541 GAGCAGACTTTAAAAAAAAAAGG + Intergenic
1202126468 Y:21573073-21573095 GTGCATACTGTAAAGAAATAGGG + Intergenic
1202141312 Y:21726411-21726433 CTGAACACATTAAATAAAAAGGG - Intergenic
1202145553 Y:21777391-21777413 CTGAACACATTAAATAAAAAGGG + Intergenic
1202151761 Y:21850063-21850085 CTGTCTAGTTTAAAAAAAAAAGG - Intergenic
1202152445 Y:21855772-21855794 GTGCATACTGTAAAGAAATAGGG - Intergenic
1202328084 Y:23713905-23713927 TTGCTTAATTAAAAAAAAAAAGG - Intergenic
1202334112 Y:23788808-23788830 CTGGAAATTTTAATAAAAAATGG + Intergenic
1202536656 Y:25881251-25881273 CTGGAAATTTTAATAAAAAATGG - Intergenic
1202542686 Y:25956147-25956169 TTGCTTAATTAAAAAAAAAAAGG + Intergenic