ID: 1131390450

View in Genome Browser
Species Human (GRCh38)
Location 15:92043881-92043903
Sequence AGGGAGAAACAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3279
Summary {0: 1, 1: 1, 2: 35, 3: 340, 4: 2902}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131390450_1131390459 1 Left 1131390450 15:92043881-92043903 CCTCCCTCCTCCTGTTTCTCCCT 0: 1
1: 1
2: 35
3: 340
4: 2902
Right 1131390459 15:92043905-92043927 GTCGGTTTTTCCATCCCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 57
1131390450_1131390460 2 Left 1131390450 15:92043881-92043903 CCTCCCTCCTCCTGTTTCTCCCT 0: 1
1: 1
2: 35
3: 340
4: 2902
Right 1131390460 15:92043906-92043928 TCGGTTTTTCCATCCCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131390450 Original CRISPR AGGGAGAAACAGGAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr