ID: 1131392127

View in Genome Browser
Species Human (GRCh38)
Location 15:92058203-92058225
Sequence TAGCATCTCTAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131392127 Original CRISPR TAGCATCTCTAGAAGGTGGA GGG Intronic
900730419 1:4255317-4255339 TATGTACTCTAGAAGGTGGAAGG + Intergenic
904235508 1:29114086-29114108 AACCATCTCTAGAAGGGGCAAGG - Intronic
906646025 1:47475700-47475722 TACCTTCTATAGAAGCTGGATGG - Intergenic
908154834 1:61342017-61342039 TAGCATGTCTAGAATGGGGCCGG + Intronic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
920618725 1:207522666-207522688 TAGCCTTTCTTGAGGGTGGATGG + Intronic
923284707 1:232482397-232482419 CAGCATCTCTAGGGGGTGAATGG + Intronic
923797320 1:237170371-237170393 TATCCACTGTAGAAGGTGGAAGG + Intronic
1068627262 10:59262849-59262871 TAGGATCTCATGGAGGTGGAGGG + Intronic
1070194672 10:74146198-74146220 TAGCAAATATGGAAGGTGGAGGG + Intronic
1071988367 10:91075278-91075300 TGGCAGAACTAGAAGGTGGAAGG + Intergenic
1074364788 10:112849278-112849300 AAACATCTCCAGCAGGTGGAGGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1081680865 11:45001419-45001441 TACCTTCTTTACAAGGTGGAAGG - Intergenic
1082827835 11:57593785-57593807 TAGAATCTCTTGAACCTGGAAGG - Intergenic
1089744593 11:120607867-120607889 GAGCAACTGGAGAAGGTGGAGGG + Intronic
1093699637 12:22204432-22204454 TAACTGCTCTAGAAGGTTGATGG - Intronic
1096113405 12:49041591-49041613 TGGCCTCTCTTGAGGGTGGAGGG - Intronic
1098022521 12:66170511-66170533 TAGCAACTCTCCAAGGTGAAAGG - Intergenic
1099712625 12:86246359-86246381 TAGACTCTCTAGAAGGTTGCAGG - Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1102864865 12:116366477-116366499 TAGCATATCATGAAGGGGGAGGG - Intergenic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1110479933 13:75962172-75962194 TAGCAGCTCCATAATGTGGAAGG + Intergenic
1112629150 13:101141442-101141464 TAGCATCTCTAGATGGCTGAAGG + Intronic
1114914010 14:27239375-27239397 AAGCATCTCTAGAAGAATGAAGG + Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1122802256 14:104237618-104237640 TAGCAGCACTGGAAGGTGGTGGG - Intergenic
1130134234 15:81168600-81168622 TAGAATCTCCAGAAGATGCACGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131392127 15:92058203-92058225 TAGCATCTCTAGAAGGTGGAGGG + Intronic
1138093675 16:54195822-54195844 TTGCATCTCCAGAAGGGGCAGGG + Intergenic
1141362635 16:83410369-83410391 TAACATTTTTAGAAGATGGAAGG - Intronic
1143057079 17:4170461-4170483 TGGCATTTCTAGAAGGTTGTGGG + Intronic
1146726337 17:35159402-35159424 TAGCATGTCCAGCAGGTGGCTGG - Exonic
1147362849 17:39942577-39942599 TTGCTTCTCTAGGAGTTGGAAGG - Intronic
1151809578 17:76430162-76430184 TCCAATTTCTAGAAGGTGGAAGG - Intronic
1157021870 18:43792863-43792885 TAGATTGTCTAGAAGCTGGAGGG - Intergenic
1157536854 18:48465864-48465886 CAGCATCTCTGGCAGGTGCAAGG - Intergenic
1157818147 18:50745855-50745877 TAGTATCTCTCGAAATTGGAGGG + Intergenic
1158432138 18:57398837-57398859 TAGCACCTCTGCAAGCTGGAAGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1167940084 19:52939741-52939763 GAGAATCACTTGAAGGTGGAAGG - Intronic
926663540 2:15494652-15494674 TAGCATTTATATAATGTGGATGG - Intronic
927075225 2:19570889-19570911 TACCACCTCTCTAAGGTGGATGG + Intergenic
932599042 2:73111784-73111806 TGACATCTCTAGATAGTGGAGGG + Intronic
938697295 2:133845695-133845717 TCGCATTTCTAGCAGGAGGAAGG - Intergenic
938743031 2:134250915-134250937 TAGCTTCCTTAGAAGGTAGAAGG - Intronic
939008033 2:136811426-136811448 AACCATCCCAAGAAGGTGGAGGG - Intronic
939181573 2:138809186-138809208 TAGCATTTTTAGAATGTGGAGGG + Intergenic
942572694 2:177329773-177329795 TACCCTCTCTAGAAGTTGGAAGG + Intronic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
948438559 2:237970249-237970271 TAGCTGCTTTAGGAGGTGGAGGG + Intronic
1168889309 20:1283916-1283938 TAGGATTTCTAGAAGGTAGCTGG - Intronic
1174898678 20:54476071-54476093 CAGCATCCCTGGAGGGTGGACGG + Intronic
1175560580 20:59925623-59925645 TAGACTCTTTTGAAGGTGGAAGG - Intronic
1177093155 21:16796072-16796094 TACCATCTCTATAAGCTGTAGGG + Intergenic
1179039437 21:37789163-37789185 TTGCATCTCTAGTAGGAAGAAGG - Intronic
1180797384 22:18612739-18612761 GAGAATCTCTTGAACGTGGAAGG - Intergenic
1181224341 22:21382545-21382567 GAGAATCTCTTGAACGTGGAAGG + Intergenic
1181254291 22:21552278-21552300 GAGAATCTCTTGAACGTGGAAGG - Intronic
1182087506 22:27571479-27571501 TAGTATCTCTAGGAAGGGGAAGG + Intergenic
1182874573 22:33679909-33679931 TGGCATCTCCAGAAGGAGTATGG + Intronic
1183409966 22:37649050-37649072 GCCCATCTCTGGAAGGTGGAGGG - Intronic
1183774269 22:39953025-39953047 TAACATCACTCCAAGGTGGAAGG - Intronic
949204270 3:1419759-1419781 TAGCTTCTCAACAAGATGGAGGG - Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
952566905 3:34669564-34669586 TAGCATCTCTGGATGCAGGAGGG + Intergenic
953022278 3:39122375-39122397 TCACATTTCTAGAAGATGGAAGG + Intronic
953249744 3:41233914-41233936 AAGCATCTCTAGCTGTTGGATGG + Intronic
954429289 3:50461262-50461284 TAGCAACTCAAGAAGCTGGAAGG + Intronic
954951718 3:54480662-54480684 AAATATCTCTAGAAGGAGGAAGG - Intronic
955480763 3:59387185-59387207 GAGAGTCTCTAGAAGGTAGAAGG + Intergenic
955960090 3:64331648-64331670 TTGCAGCTCTAGGAGGAGGAAGG + Intronic
956065946 3:65397341-65397363 TAGCATCTCTTGCAGGGGAAAGG + Intronic
957398749 3:79680827-79680849 AAGAATCTCTAGGAGGTGGGGGG + Intronic
960233162 3:115252780-115252802 TAGCACATGTAGAAAGTGGAAGG + Intergenic
967871001 3:194228990-194229012 GAGCATCTGTAGAGGGTGGGGGG - Intergenic
970567209 4:17343316-17343338 TAGGATTTCGAGAAGGTGGGTGG - Intergenic
972261930 4:37417492-37417514 TTGCATCTTTGGAAGGAGGAGGG + Intronic
973024595 4:45251500-45251522 CACCATTTCTAGATGGTGGATGG - Intergenic
983930086 4:173444061-173444083 TAGAATCTCTTGAAACTGGAAGG - Intergenic
984720306 4:182966043-182966065 TAGCATCTGTAGAGGGAGAATGG - Intergenic
985263492 4:188136852-188136874 CAGCATCTGTAGAAGGTAGTTGG + Intergenic
989819324 5:45776250-45776272 GGGAATCTCCAGAAGGTGGAGGG - Intergenic
992353630 5:75956569-75956591 TATCATCTCTTGTAGATGGAGGG + Intergenic
993167286 5:84373494-84373516 TAGCATCTATAGATCCTGGAAGG - Intronic
993777268 5:92014874-92014896 TGGCATCTGTAGTAAGTGGATGG - Intergenic
994797971 5:104331042-104331064 TAAAATTTCTAGAAGATGGATGG - Intergenic
996366434 5:122706189-122706211 TAGCAACTGTTGGAGGTGGAAGG - Intergenic
997867364 5:137476451-137476473 GTGAATATCTAGAAGGTGGAAGG + Intronic
998569738 5:143246440-143246462 TAGCATGTCTTCAAGGTGCAGGG - Intergenic
1001183205 5:169540288-169540310 TAGCATATCTCGAGGGAGGATGG + Intergenic
1006144500 6:31950455-31950477 TAGGATCTGTAGAAAGTGGGAGG - Intronic
1009385283 6:63079511-63079533 TTGCATATTTAGAAGTTGGAAGG + Intergenic
1011482952 6:87813308-87813330 GAGCTTCTCAGGAAGGTGGAAGG + Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013169338 6:107622185-107622207 CAGCAGCTCTTGAAGGTAGACGG + Intronic
1014571829 6:123019003-123019025 CAGCAGCGCAAGAAGGTGGAAGG - Intronic
1015705600 6:136084410-136084432 TAGAATCTCTAGAAAGGGAAGGG + Intronic
1016196558 6:141350646-141350668 TAGCATATCTAGAAGGTGACAGG + Intergenic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1023112845 7:36831434-36831456 AAACATCTCTAGAAGGGGCATGG + Intergenic
1023345875 7:39270760-39270782 ACACATCTCTAGAATGTGGATGG + Intronic
1024539143 7:50461771-50461793 AAGCATCTCTGGAAGGTAGTGGG - Intronic
1024957991 7:54946088-54946110 TATGATCTCTAGAAAGTTGATGG - Intergenic
1028697446 7:93731411-93731433 TACCATCTCTAGAAGGAGAATGG + Intronic
1028853045 7:95558011-95558033 TAGCATGTCTAGAAGGAGTGAGG + Intergenic
1029430413 7:100525400-100525422 TAGCAACCCTGGAAGGTAGAAGG - Intergenic
1031661860 7:124435700-124435722 TACCTTCTTTACAAGGTGGAAGG + Intergenic
1039318868 8:36405782-36405804 TAGCATCCAAAGATGGTGGAGGG - Intergenic
1039921042 8:41895052-41895074 GAGCATCTCTAGGAAGAGGATGG + Intronic
1042199367 8:66266234-66266256 TAGCTTTTCTAGTAGGTGTAAGG - Intergenic
1045379879 8:101612449-101612471 TAGCATCTTCAGAGTGTGGATGG + Intronic
1048770512 8:137889949-137889971 GAGCATCTCAAGGAGGTGGCAGG - Intergenic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1049867962 8:144950921-144950943 TAGCCTCTCTAGATGGCGGGAGG + Intergenic
1055355322 9:75431669-75431691 TAGCACTCCTAGATGGTGGAGGG + Intergenic
1055398349 9:75897088-75897110 CAGCAACTCTATGAGGTGGATGG - Intronic
1058779604 9:108319575-108319597 TAGCAACCCTTGAAGATGGAAGG + Intergenic
1062289284 9:135787320-135787342 TAGCATCTCTAGAGTGAGGGAGG - Intronic
1186691696 X:11984729-11984751 TATCATCTCAAGAAAGTGAAAGG + Intergenic
1188765328 X:34083704-34083726 TACCATCTCTAGAAAGCTGAAGG - Intergenic
1189884788 X:45531088-45531110 TAGCATCTTGAAAAGCTGGAAGG + Intergenic
1190929069 X:54933342-54933364 TAGCATTTCCTAAAGGTGGAAGG + Exonic
1192188745 X:68977981-68978003 AAGCAACTTTAGAAGGTGGAAGG - Intergenic
1193021683 X:76799232-76799254 TTGCAGATCTAGAAGGTGCAGGG + Intergenic
1197681188 X:129387011-129387033 TAGCATCTTTAGAGGGAGCATGG + Intergenic
1197690631 X:129497025-129497047 TAGCATCTCTTGAAGGTGTGTGG - Intronic
1199726405 X:150586935-150586957 AAGCATCTCTGGTAGGAGGAAGG + Intronic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic